ID: 1188890811

View in Genome Browser
Species Human (GRCh38)
Location X:35609789-35609811
Sequence ACTAAATGTTTCACGCATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188890811_1188890813 -9 Left 1188890811 X:35609789-35609811 CCTGGATGCGTGAAACATTTAGT No data
Right 1188890813 X:35609803-35609825 ACATTTAGTGCTGAAGGCCCAGG No data
1188890811_1188890818 9 Left 1188890811 X:35609789-35609811 CCTGGATGCGTGAAACATTTAGT No data
Right 1188890818 X:35609821-35609843 CCAGGTCAGAGGGACTCCTTCGG No data
1188890811_1188890819 10 Left 1188890811 X:35609789-35609811 CCTGGATGCGTGAAACATTTAGT No data
Right 1188890819 X:35609822-35609844 CAGGTCAGAGGGACTCCTTCGGG No data
1188890811_1188890815 -1 Left 1188890811 X:35609789-35609811 CCTGGATGCGTGAAACATTTAGT No data
Right 1188890815 X:35609811-35609833 TGCTGAAGGCCCAGGTCAGAGGG No data
1188890811_1188890814 -2 Left 1188890811 X:35609789-35609811 CCTGGATGCGTGAAACATTTAGT No data
Right 1188890814 X:35609810-35609832 GTGCTGAAGGCCCAGGTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188890811 Original CRISPR ACTAAATGTTTCACGCATCC AGG (reversed) Intergenic