ID: 1188891633

View in Genome Browser
Species Human (GRCh38)
Location X:35618489-35618511
Sequence GTTGTATAATGATCAAAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188891633_1188891634 -10 Left 1188891633 X:35618489-35618511 CCTGATTTTGATCATTATACAAC No data
Right 1188891634 X:35618502-35618524 ATTATACAACATATATATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188891633 Original CRISPR GTTGTATAATGATCAAAATC AGG (reversed) Intergenic
No off target data available for this crispr