ID: 1188891634

View in Genome Browser
Species Human (GRCh38)
Location X:35618502-35618524
Sequence ATTATACAACATATATATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188891633_1188891634 -10 Left 1188891633 X:35618489-35618511 CCTGATTTTGATCATTATACAAC No data
Right 1188891634 X:35618502-35618524 ATTATACAACATATATATGTAGG No data
1188891631_1188891634 -2 Left 1188891631 X:35618481-35618503 CCAAATACCCTGATTTTGATCAT No data
Right 1188891634 X:35618502-35618524 ATTATACAACATATATATGTAGG No data
1188891632_1188891634 -9 Left 1188891632 X:35618488-35618510 CCCTGATTTTGATCATTATACAA No data
Right 1188891634 X:35618502-35618524 ATTATACAACATATATATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188891634 Original CRISPR ATTATACAACATATATATGT AGG Intergenic
No off target data available for this crispr