ID: 1188892314

View in Genome Browser
Species Human (GRCh38)
Location X:35625945-35625967
Sequence GCGGCTGGTGGGGAGCATGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188892303_1188892314 18 Left 1188892303 X:35625904-35625926 CCTGCCGGTGGGACGCGGGCTTG No data
Right 1188892314 X:35625945-35625967 GCGGCTGGTGGGGAGCATGGCGG No data
1188892305_1188892314 14 Left 1188892305 X:35625908-35625930 CCGGTGGGACGCGGGCTTGAGGA No data
Right 1188892314 X:35625945-35625967 GCGGCTGGTGGGGAGCATGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188892314 Original CRISPR GCGGCTGGTGGGGAGCATGG CGG Intergenic
No off target data available for this crispr