ID: 1188895136

View in Genome Browser
Species Human (GRCh38)
Location X:35658640-35658662
Sequence TTTTCAACCCAGATGGACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188895130_1188895136 23 Left 1188895130 X:35658594-35658616 CCCAGGCTAATCACAATTCTCAC No data
Right 1188895136 X:35658640-35658662 TTTTCAACCCAGATGGACCTGGG No data
1188895133_1188895136 -7 Left 1188895133 X:35658624-35658646 CCATGGTTGACAAAGATTTTCAA No data
Right 1188895136 X:35658640-35658662 TTTTCAACCCAGATGGACCTGGG No data
1188895131_1188895136 22 Left 1188895131 X:35658595-35658617 CCAGGCTAATCACAATTCTCACA No data
Right 1188895136 X:35658640-35658662 TTTTCAACCCAGATGGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188895136 Original CRISPR TTTTCAACCCAGATGGACCT GGG Intergenic
No off target data available for this crispr