ID: 1188896363

View in Genome Browser
Species Human (GRCh38)
Location X:35673501-35673523
Sequence GTACAATCAGGGGCTCAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188896363_1188896368 -9 Left 1188896363 X:35673501-35673523 CCTCCTTGAGCCCCTGATTGTAC No data
Right 1188896368 X:35673515-35673537 TGATTGTACTTTCTGCTTCTAGG No data
1188896363_1188896369 24 Left 1188896363 X:35673501-35673523 CCTCCTTGAGCCCCTGATTGTAC No data
Right 1188896369 X:35673548-35673570 GTTTACATACCTCATATAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188896363 Original CRISPR GTACAATCAGGGGCTCAAGG AGG (reversed) Intergenic
No off target data available for this crispr