ID: 1188897338

View in Genome Browser
Species Human (GRCh38)
Location X:35685772-35685794
Sequence GTGCCACGCAGCTGCTGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188897338_1188897340 2 Left 1188897338 X:35685772-35685794 CCCTGGCAGCAGCTGCGTGGCAC No data
Right 1188897340 X:35685797-35685819 AGAGCGAATCTGTATACTTGAGG No data
1188897338_1188897342 7 Left 1188897338 X:35685772-35685794 CCCTGGCAGCAGCTGCGTGGCAC No data
Right 1188897342 X:35685802-35685824 GAATCTGTATACTTGAGGAAGGG No data
1188897338_1188897346 26 Left 1188897338 X:35685772-35685794 CCCTGGCAGCAGCTGCGTGGCAC No data
Right 1188897346 X:35685821-35685843 AGGGAGATAGCAGTGACTGGGGG No data
1188897338_1188897341 6 Left 1188897338 X:35685772-35685794 CCCTGGCAGCAGCTGCGTGGCAC No data
Right 1188897341 X:35685801-35685823 CGAATCTGTATACTTGAGGAAGG No data
1188897338_1188897345 25 Left 1188897338 X:35685772-35685794 CCCTGGCAGCAGCTGCGTGGCAC No data
Right 1188897345 X:35685820-35685842 AAGGGAGATAGCAGTGACTGGGG No data
1188897338_1188897343 23 Left 1188897338 X:35685772-35685794 CCCTGGCAGCAGCTGCGTGGCAC No data
Right 1188897343 X:35685818-35685840 GGAAGGGAGATAGCAGTGACTGG No data
1188897338_1188897344 24 Left 1188897338 X:35685772-35685794 CCCTGGCAGCAGCTGCGTGGCAC No data
Right 1188897344 X:35685819-35685841 GAAGGGAGATAGCAGTGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188897338 Original CRISPR GTGCCACGCAGCTGCTGCCA GGG (reversed) Intergenic
No off target data available for this crispr