ID: 1188897346

View in Genome Browser
Species Human (GRCh38)
Location X:35685821-35685843
Sequence AGGGAGATAGCAGTGACTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188897338_1188897346 26 Left 1188897338 X:35685772-35685794 CCCTGGCAGCAGCTGCGTGGCAC No data
Right 1188897346 X:35685821-35685843 AGGGAGATAGCAGTGACTGGGGG No data
1188897337_1188897346 27 Left 1188897337 X:35685771-35685793 CCCCTGGCAGCAGCTGCGTGGCA No data
Right 1188897346 X:35685821-35685843 AGGGAGATAGCAGTGACTGGGGG No data
1188897339_1188897346 25 Left 1188897339 X:35685773-35685795 CCTGGCAGCAGCTGCGTGGCACA No data
Right 1188897346 X:35685821-35685843 AGGGAGATAGCAGTGACTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188897346 Original CRISPR AGGGAGATAGCAGTGACTGG GGG Intergenic
No off target data available for this crispr