ID: 1188904345

View in Genome Browser
Species Human (GRCh38)
Location X:35774300-35774322
Sequence GATCCTATATCCAAAGGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188904338_1188904345 2 Left 1188904338 X:35774275-35774297 CCCCCTTGCATTCCCTGGGTAGC No data
Right 1188904345 X:35774300-35774322 GATCCTATATCCAAAGGATTTGG No data
1188904334_1188904345 21 Left 1188904334 X:35774256-35774278 CCCTGCTTATGAGTATTCTCCCC No data
Right 1188904345 X:35774300-35774322 GATCCTATATCCAAAGGATTTGG No data
1188904340_1188904345 0 Left 1188904340 X:35774277-35774299 CCCTTGCATTCCCTGGGTAGCAA No data
Right 1188904345 X:35774300-35774322 GATCCTATATCCAAAGGATTTGG No data
1188904335_1188904345 20 Left 1188904335 X:35774257-35774279 CCTGCTTATGAGTATTCTCCCCC No data
Right 1188904345 X:35774300-35774322 GATCCTATATCCAAAGGATTTGG No data
1188904341_1188904345 -1 Left 1188904341 X:35774278-35774300 CCTTGCATTCCCTGGGTAGCAAG No data
Right 1188904345 X:35774300-35774322 GATCCTATATCCAAAGGATTTGG No data
1188904339_1188904345 1 Left 1188904339 X:35774276-35774298 CCCCTTGCATTCCCTGGGTAGCA No data
Right 1188904345 X:35774300-35774322 GATCCTATATCCAAAGGATTTGG No data
1188904342_1188904345 -10 Left 1188904342 X:35774287-35774309 CCCTGGGTAGCAAGATCCTATAT No data
Right 1188904345 X:35774300-35774322 GATCCTATATCCAAAGGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188904345 Original CRISPR GATCCTATATCCAAAGGATT TGG Intergenic
No off target data available for this crispr