ID: 1188905770

View in Genome Browser
Species Human (GRCh38)
Location X:35789429-35789451
Sequence GCTTAAGCATGTGCACTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188905770_1188905777 18 Left 1188905770 X:35789429-35789451 CCTCTTAGTGCACATGCTTAAGC No data
Right 1188905777 X:35789470-35789492 AGATCTTATCAGGAAGCTGCTGG No data
1188905770_1188905775 8 Left 1188905770 X:35789429-35789451 CCTCTTAGTGCACATGCTTAAGC No data
Right 1188905775 X:35789460-35789482 CCAGCTCCTGAGATCTTATCAGG 0: 38
1: 178
2: 299
3: 290
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188905770 Original CRISPR GCTTAAGCATGTGCACTAAG AGG (reversed) Intergenic
No off target data available for this crispr