ID: 1188907056

View in Genome Browser
Species Human (GRCh38)
Location X:35801811-35801833
Sequence CCTATCAGGTGCCAAGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 59}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188907049_1188907056 7 Left 1188907049 X:35801781-35801803 CCACATTACCACAGGGGAAGTGG 0: 1
1: 0
2: 1
3: 14
4: 156
Right 1188907056 X:35801811-35801833 CCTATCAGGTGCCAAGTTACTGG 0: 1
1: 0
2: 0
3: 3
4: 59
1188907052_1188907056 -1 Left 1188907052 X:35801789-35801811 CCACAGGGGAAGTGGCACAGGCC 0: 1
1: 0
2: 4
3: 23
4: 305
Right 1188907056 X:35801811-35801833 CCTATCAGGTGCCAAGTTACTGG 0: 1
1: 0
2: 0
3: 3
4: 59
1188907047_1188907056 9 Left 1188907047 X:35801779-35801801 CCCCACATTACCACAGGGGAAGT 0: 1
1: 0
2: 0
3: 12
4: 127
Right 1188907056 X:35801811-35801833 CCTATCAGGTGCCAAGTTACTGG 0: 1
1: 0
2: 0
3: 3
4: 59
1188907048_1188907056 8 Left 1188907048 X:35801780-35801802 CCCACATTACCACAGGGGAAGTG 0: 1
1: 0
2: 0
3: 10
4: 145
Right 1188907056 X:35801811-35801833 CCTATCAGGTGCCAAGTTACTGG 0: 1
1: 0
2: 0
3: 3
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188907056 Original CRISPR CCTATCAGGTGCCAAGTTAC TGG Intronic
901043254 1:6378701-6378723 CCTATCATGTGCCATGGGACAGG + Intronic
902436258 1:16399858-16399880 CCTACTATGTGCCAAGTAACAGG - Intronic
907725173 1:57013726-57013748 CTTATCAGGTGTCAAGGCACAGG + Intronic
907759773 1:57345918-57345940 ATTAACAGGTGTCAAGTTACTGG + Intronic
908787536 1:67749890-67749912 CCTCTCAGGTGCTGAGTCACTGG + Intronic
910405419 1:86884058-86884080 CCTGTCTGCTGTCAAGTTACAGG - Intronic
915175132 1:154008223-154008245 CCTACCAGGTGATGAGTTACAGG - Intronic
916059212 1:161087308-161087330 CCTACCAGGTGCCAGCTTCCTGG + Intronic
918686310 1:187420175-187420197 TCTATCAGCTGGCAAATTACAGG - Intergenic
920050171 1:203159743-203159765 CCTATCAGGTGCCAGGTTCTAGG - Intronic
920057098 1:203200806-203200828 CCTATTAGGTGCCAAGTCCTGGG + Intergenic
1079309982 11:19356594-19356616 CCTATAAGGGGCCAAGTGAAAGG + Intronic
1079728401 11:23907074-23907096 CCTGTCAGGCCCAAAGTTACAGG - Intergenic
1080194156 11:29588333-29588355 CCTACCAGGTGCTAAGTTAATGG - Intergenic
1088396600 11:109376555-109376577 CCTACCAGGGGCCAAGTAAATGG + Intergenic
1090215338 11:124957287-124957309 CCCAGCAGGTGCCACATTACTGG - Intronic
1092513590 12:9184517-9184539 GCTAGCAGGTGCCAGGTTGCTGG - Intronic
1100482137 12:94989310-94989332 CCTACCAGGTGCCAAGAACCTGG - Intronic
1100598304 12:96090377-96090399 CATATCAGTTGCTAAGTTTCTGG - Intergenic
1102987038 12:117286544-117286566 CCTGTCAGGTGACAACTGACAGG - Intronic
1106798345 13:33230914-33230936 CCTGTGAAGTGCCAAGATACGGG + Intronic
1108075103 13:46671392-46671414 CCTATCAGGTGCCAGGCACCTGG - Intronic
1110025482 13:70533556-70533578 CATATCAGGTGCCATCTTAAAGG - Intergenic
1113834523 13:113319918-113319940 TCTATCAGGGGCCAAGTTGTAGG - Intronic
1114511069 14:23261582-23261604 TTTATCAGGTACCATGTTACAGG + Intronic
1120107100 14:80508240-80508262 ACTATCATATGCCAAGTAACTGG - Intronic
1142244897 16:88965905-88965927 CCTGTCAGGTGCCAAGCACCAGG - Intronic
1142800861 17:2344674-2344696 CTTATCACATGCCAAGTTATTGG - Intronic
1149361814 17:55903069-55903091 CATAACTTGTGCCAAGTTACAGG - Intergenic
1157151665 18:45224391-45224413 CCAATCAGGTGCCAGGTTGGAGG + Intronic
926125150 2:10267510-10267532 CTTATCAGGTGCCAAGTGCTGGG + Intergenic
930530155 2:52579903-52579925 CCTTTCAGGTGCCAAGATTCTGG - Intergenic
930712872 2:54565655-54565677 CCTTACAGATGCCAAGTTGCTGG - Intronic
932005462 2:67922697-67922719 GCTATCAGGAGCCAATTTGCTGG - Intergenic
933039842 2:77450337-77450359 CTCATCAGGTACAAAGTTACAGG + Intronic
941200953 2:162509687-162509709 CTTATCAGATGACAAGATACTGG + Intronic
1173185676 20:40838170-40838192 TCTACTAGGTGCCAAGTTCCAGG + Intergenic
1182573971 22:31260299-31260321 CCTTTCAGGTGTCAGGTTTCAGG + Intronic
1184860572 22:47171295-47171317 CCTAGCAGGTGACAAGGGACAGG - Intronic
954249806 3:49358703-49358725 CCTCTCCTGTGCCATGTTACCGG + Intergenic
955616073 3:60807963-60807985 CCTATGAGGTCCCCAGTTTCAGG - Intronic
958113590 3:89184326-89184348 CTTAGTAGGTTCCAAGTTACAGG + Intronic
963355272 3:144203343-144203365 CCTAGGAAGTGCCAAGTTTCTGG - Intergenic
971246273 4:24931381-24931403 CCTATCATGTGCTAAGGCACTGG - Intronic
977840667 4:101699798-101699820 CCTATCAGGTCCCACGTAATTGG + Intronic
983718466 4:170816083-170816105 GCTAAGAGGTGCCAAGGTACAGG + Intergenic
990869356 5:60415009-60415031 CCTACCATGTGACAAGGTACTGG - Intronic
992416354 5:76555912-76555934 TCTGTAAGGTGCCAAGTGACTGG - Intronic
994604590 5:101951966-101951988 CCTGTTAGGTCCCCAGTTACTGG + Intergenic
995366286 5:111365080-111365102 ACTATCAAGTGCCAAGTGAAAGG + Intronic
999321001 5:150615057-150615079 CCTAGCAGGTGCTCAGTTAGTGG + Intronic
1016228476 6:141771934-141771956 CTCATCAGGTCCCCAGTTACAGG - Intergenic
1025869934 7:65422186-65422208 CCTATAAGGTGCCATGGTATTGG - Intergenic
1028204792 7:88004182-88004204 ACTAACAGGTACCAAATTACAGG - Intronic
1028692698 7:93671687-93671709 AACATCAGGTGCCAAGATACAGG - Intronic
1036617907 8:10403194-10403216 AGTCTCAGGTGCCAAGTTTCCGG - Intronic
1039386217 8:37138069-37138091 CCCATCAGGGACCAAGTTGCAGG + Intergenic
1044933277 8:97270522-97270544 CCTGTCAGGTGTCCAGCTACTGG - Intergenic
1051851316 9:21512179-21512201 CCTCTCCAGTTCCAAGTTACAGG + Intergenic
1052591206 9:30497884-30497906 GCTAGCAGGTGCCAGGGTACTGG + Intergenic
1060563254 9:124565984-124566006 CCTATCAGGAGGCAAGTTCAAGG + Intronic
1188907056 X:35801811-35801833 CCTATCAGGTGCCAAGTTACTGG + Intronic
1189485719 X:41430143-41430165 CCCATCAGGTGCCAGGAGACAGG - Intergenic