ID: 1188910264

View in Genome Browser
Species Human (GRCh38)
Location X:35839088-35839110
Sequence CACCCCATGCTGTGGCCTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188910264_1188910269 7 Left 1188910264 X:35839088-35839110 CCACTAGGCCACAGCATGGGGTG No data
Right 1188910269 X:35839118-35839140 TTGCAGCCAGCAGGCTGCATAGG No data
1188910264_1188910267 -2 Left 1188910264 X:35839088-35839110 CCACTAGGCCACAGCATGGGGTG No data
Right 1188910267 X:35839109-35839131 TGGTCTCCATTGCAGCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188910264 Original CRISPR CACCCCATGCTGTGGCCTAG TGG (reversed) Intergenic
No off target data available for this crispr