ID: 1188912110

View in Genome Browser
Species Human (GRCh38)
Location X:35862321-35862343
Sequence ACCCCCAGAGTCAAATCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188912110_1188912111 14 Left 1188912110 X:35862321-35862343 CCAAGTGATTTGACTCTGGGGGT No data
Right 1188912111 X:35862358-35862380 TAGTGTTCTCAATATGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188912110 Original CRISPR ACCCCCAGAGTCAAATCACT TGG (reversed) Intergenic
No off target data available for this crispr