ID: 1188914389

View in Genome Browser
Species Human (GRCh38)
Location X:35891520-35891542
Sequence TGGATTTCAACCCTAGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188914381_1188914389 5 Left 1188914381 X:35891492-35891514 CCATGGCTGTGGTCTCTCCAACA No data
Right 1188914389 X:35891520-35891542 TGGATTTCAACCCTAGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188914389 Original CRISPR TGGATTTCAACCCTAGGGGA GGG Intergenic
No off target data available for this crispr