ID: 1188916562

View in Genome Browser
Species Human (GRCh38)
Location X:35918871-35918893
Sequence GGAACCTTGTTAACTGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188916562_1188916564 2 Left 1188916562 X:35918871-35918893 CCTGGAACAGTTAACAAGGTTCC No data
Right 1188916564 X:35918896-35918918 AAGCCTCTATATTCAATGTGTGG No data
1188916562_1188916566 8 Left 1188916562 X:35918871-35918893 CCTGGAACAGTTAACAAGGTTCC No data
Right 1188916566 X:35918902-35918924 CTATATTCAATGTGTGGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188916562 Original CRISPR GGAACCTTGTTAACTGTTCC AGG (reversed) Intergenic
No off target data available for this crispr