ID: 1188916634

View in Genome Browser
Species Human (GRCh38)
Location X:35919756-35919778
Sequence AAAACAGATGTGGATCCGTC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 476
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 464}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188916634_1188916637 -8 Left 1188916634 X:35919756-35919778 CCGGACGGATCCACATCTGTTTT 0: 1
1: 0
2: 0
3: 11
4: 464
Right 1188916637 X:35919771-35919793 TCTGTTTTCTGGCTACCGAGAGG 0: 1
1: 0
2: 0
3: 9
4: 117
1188916634_1188916641 15 Left 1188916634 X:35919756-35919778 CCGGACGGATCCACATCTGTTTT 0: 1
1: 0
2: 0
3: 11
4: 464
Right 1188916641 X:35919794-35919816 GCAGCCATGAACACCCAAAAGGG 0: 1
1: 0
2: 2
3: 14
4: 182
1188916634_1188916638 -7 Left 1188916634 X:35919756-35919778 CCGGACGGATCCACATCTGTTTT 0: 1
1: 0
2: 0
3: 11
4: 464
Right 1188916638 X:35919772-35919794 CTGTTTTCTGGCTACCGAGAGGG 0: 1
1: 0
2: 1
3: 11
4: 99
1188916634_1188916640 14 Left 1188916634 X:35919756-35919778 CCGGACGGATCCACATCTGTTTT 0: 1
1: 0
2: 0
3: 11
4: 464
Right 1188916640 X:35919793-35919815 GGCAGCCATGAACACCCAAAAGG 0: 1
1: 0
2: 0
3: 10
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188916634 Original CRISPR AAAACAGATGTGGATCCGTC CGG (reversed) Exonic
902102175 1:14000086-14000108 AATTCAGCTGTGAATCCGTCTGG - Intergenic
905051666 1:35056734-35056756 AATTCAGCTGTGAATCCGTCTGG + Intergenic
906452626 1:45964320-45964342 AATTCAGCTGTGGATCCATCTGG + Intronic
906808147 1:48800102-48800124 AAATCAGCTGTGAATCCATCTGG + Intronic
906871120 1:49482234-49482256 AAATCAGCTGTGAATCCATCTGG + Intronic
908210838 1:61898125-61898147 AAAACAGATTTGGATACATGAGG + Intronic
908567772 1:65375992-65376014 AATACAGCAGTGAATCCGTCAGG + Intronic
908929261 1:69297417-69297439 AATTCAGCTGTGAATCCGTCTGG + Intergenic
908972707 1:69856650-69856672 AATTCAGCTGTGAATCCGTCTGG - Intronic
908981088 1:69960089-69960111 AATTCAGCTGTGAATCCGTCTGG + Intronic
909243355 1:73243528-73243550 AATTCAGATGTGAATCCATCTGG - Intergenic
909401165 1:75232498-75232520 AAATAAGAGGTGGATCAGTCTGG - Intronic
909689567 1:78391894-78391916 AATTCAGATGTGAATCTGTCTGG + Intronic
911607934 1:99929351-99929373 AAAAGAGAGGTGGATACTTCTGG + Intergenic
912035575 1:105307853-105307875 AATTCAGCTGTGAATCCGTCTGG + Intergenic
912133042 1:106625375-106625397 AAATCAGCTGTGAATCTGTCTGG + Intergenic
912580879 1:110719858-110719880 AAAAGAGATGTGGCTCAGTTTGG + Intergenic
915181695 1:154066979-154067001 AATTCAGCTGTGAATCCGTCTGG - Intronic
917083810 1:171285304-171285326 GAGCCAGATGTGGATCCGTTAGG - Exonic
917358053 1:174146786-174146808 AATTCAGCTGTGAATCCGTCTGG - Intergenic
917584613 1:176413519-176413541 AATTCAGCTGTGAATCCGTCTGG + Intergenic
919292252 1:195647293-195647315 AATTCAGCTGTGAATCCGTCTGG + Intergenic
919485397 1:198140147-198140169 AATTCAGCTGTGAATCCGTCTGG + Intergenic
919486143 1:198149587-198149609 AAAACAGATGTAGCTGCCTCTGG + Intergenic
919571588 1:199255623-199255645 AATTCAGCTGTGAATCCGTCTGG + Intergenic
919657832 1:200214568-200214590 AAAGCAGATGTGGCTCCTTTGGG - Intergenic
919799427 1:201344503-201344525 AAAACACATGTGGCTCAGGCTGG - Intergenic
921831219 1:219729869-219729891 AATTCAGCTGTGAATCCGTCTGG + Intronic
923081058 1:230655702-230655724 AATTCAGCTGTGAATCCGTCTGG + Intronic
924292593 1:242553081-242553103 GATACAGATGTGGATCCTTGTGG + Intergenic
1063302528 10:4863998-4864020 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1064792388 10:18972779-18972801 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1067127318 10:43530072-43530094 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1067331787 10:45329239-45329261 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1068508534 10:57934350-57934372 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1068951948 10:62786169-62786191 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1069263413 10:66429290-66429312 AAATCGGCTGTGAATCCGTCTGG - Intronic
1069348638 10:67499536-67499558 AATTCAGCTGTGAATCCGTCTGG + Intronic
1071207178 10:83294974-83294996 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1072778939 10:98230185-98230207 AATTCAGCTGTGAATCCGTCTGG + Intronic
1072928900 10:99643170-99643192 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1076093383 10:127709529-127709551 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1078732581 11:13989152-13989174 AATTCAGCTGTGAATCCGTCTGG + Intronic
1078743085 11:14086750-14086772 AATTCAGCTGTGAATCCGTCTGG + Intronic
1078829114 11:14962316-14962338 AATTCAGCTGTGAATCCGTCTGG - Intronic
1078952014 11:16144887-16144909 AATTCAGCTGTGAATCCGTCTGG - Intronic
1079270464 11:18980537-18980559 AATTCAGCTGTGGATCCATCTGG + Intergenic
1079563333 11:21850209-21850231 AATTCAGCTGTGAATCCGTCCGG - Intergenic
1079705764 11:23615832-23615854 AAATCAGCTGTGAATCTGTCTGG + Intergenic
1079877573 11:25878763-25878785 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1079900077 11:26172314-26172336 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1080033269 11:27685003-27685025 AATTCAGCTGTGAATCCGTCTGG + Intronic
1080130248 11:28786139-28786161 AATTCAGCTGTGGATCCATCTGG + Intergenic
1080150648 11:29048372-29048394 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1080486220 11:32709808-32709830 AATTCAGCTGTGAATCCGTCTGG + Intronic
1081185850 11:40041565-40041587 AATTCAGATGTGAATCCGTCTGG - Intergenic
1084361594 11:68672008-68672030 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1085536225 11:77220809-77220831 AATTCAGCTGTGAATCCGTCTGG + Intronic
1086655696 11:89351700-89351722 TAAACAGATGTGTTTTCGTCTGG - Intronic
1086790647 11:91033928-91033950 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1087003127 11:93441654-93441676 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1087103497 11:94387715-94387737 AAATCGGCTGTGAATCCGTCTGG - Intronic
1087911513 11:103759638-103759660 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1087916491 11:103817415-103817437 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1090103475 11:123826779-123826801 AATTCAGTTGTGAATCCGTCTGG + Intergenic
1090315336 11:125782078-125782100 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1091015244 11:132044917-132044939 AAATCAGCTGTGAATCTGTCTGG - Intronic
1092604757 12:10106398-10106420 AATTCAGCTGTGAATCCGTCTGG - Intronic
1093069599 12:14695138-14695160 GAAACAGTTTTGGATCCTTCTGG - Intronic
1093806349 12:23437805-23437827 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1094165221 12:27436412-27436434 AGGACAAATGTGGATCCATCTGG - Intergenic
1094424790 12:30306316-30306338 CAACCAGATGTGGGTCCCTCAGG + Intergenic
1094873230 12:34611110-34611132 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1095903591 12:47354238-47354260 AAAACTGAGGTGGGTCAGTCTGG + Intergenic
1095935554 12:47676778-47676800 AATTCAGCTGTGAATCCGTCTGG - Intronic
1096681478 12:53258294-53258316 AAAAAAAATGTGGATCTGGCCGG + Intergenic
1097430394 12:59498337-59498359 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1097543909 12:60974653-60974675 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1097763040 12:63490734-63490756 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1098691986 12:73500637-73500659 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1099183729 12:79495943-79495965 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1099497893 12:83375319-83375341 AATACAGCTGTGAATCTGTCTGG + Intergenic
1100056005 12:90510466-90510488 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1100321461 12:93497105-93497127 AATTCAGCTGTGGATCTGTCTGG - Intronic
1100749007 12:97676472-97676494 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1100808597 12:98314287-98314309 AATGCAGCTGTGGATCCATCTGG - Intergenic
1100966042 12:100014215-100014237 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1101263466 12:103059364-103059386 AAATCAGCTGTGAATCCATCTGG - Intergenic
1101459942 12:104880919-104880941 AATTCAGCTGTGAATCCGTCTGG + Intronic
1101596175 12:106166976-106166998 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1101600927 12:106209380-106209402 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1101768442 12:107725646-107725668 AAATCGGCTGTGAATCCGTCTGG - Intergenic
1104086598 12:125480646-125480668 AATTCAGCTGTGAATCCGTCTGG - Intronic
1104256063 12:127139908-127139930 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1105590978 13:21792484-21792506 AAAACAGAGGTGGATGGGGCCGG - Intergenic
1105789392 13:23782993-23783015 AATTCAGCTGTGAATCCGTCTGG - Intronic
1106025990 13:25955663-25955685 AATTCAGCTGTGAATCCGTCTGG - Intronic
1107492093 13:40890478-40890500 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1107586052 13:41849591-41849613 AAAACAGAAGTGCATAGGTCAGG + Intronic
1107613809 13:42143503-42143525 AATTCAGCTGTGAATCCGTCTGG + Intronic
1108113813 13:47106151-47106173 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1108218025 13:48204394-48204416 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1109598774 13:64594956-64594978 AAATCAGCTGTGAATCCATCTGG + Intergenic
1109659443 13:65438919-65438941 AATTCAGCTGTGGATCCGTCTGG - Intergenic
1109801688 13:67387525-67387547 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1110883417 13:80601640-80601662 AAAACACATGTGGATTTGTATGG - Intergenic
1111786509 13:92793921-92793943 AATGCAGCTGTGAATCCGTCTGG - Intronic
1111953733 13:94732787-94732809 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1112411646 13:99169275-99169297 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1112437427 13:99400705-99400727 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1114259899 14:21029088-21029110 ATAACAGATGTGGACAGGTCAGG - Intronic
1114603910 14:23980340-23980362 AATTCAGCTGTGAATCCGTCTGG - Intronic
1114608920 14:24023118-24023140 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1116358030 14:43956341-43956363 AATACAGCTGTGAATCCATCTGG - Intergenic
1116765481 14:49065336-49065358 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1117204484 14:53427297-53427319 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1118043632 14:61943269-61943291 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1118950406 14:70431746-70431768 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1119717382 14:76868541-76868563 AGAACAGGTGTGGACCCCTCAGG - Intronic
1120056909 14:79934891-79934913 AAATCAGCTGTGAATCCATCTGG + Intergenic
1121759316 14:96430877-96430899 AATTCAGCTGTGAATCCGTCTGG + Intronic
1123176818 14:106427660-106427682 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1123428913 15:20197505-20197527 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1124561562 15:30778781-30778803 AAATTAGCTGTGAATCCGTCTGG - Intergenic
1126573012 15:50172088-50172110 AATACTGCTGTGAATCCGTCTGG - Intronic
1126656819 15:50986912-50986934 AATTCAGCTGTGAATCCGTCTGG + Intronic
1127090511 15:55462178-55462200 AAACCAGCTGTGAATCCATCTGG - Intronic
1127100278 15:55557380-55557402 AATTCAGCTGTGAATCCGTCTGG - Intronic
1127335699 15:57980888-57980910 AATTCAGCTGTGAATCCGTCTGG + Intronic
1127687368 15:61361726-61361748 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1128552874 15:68609552-68609574 AAAAGAGATGTGGATTCGGGAGG - Intronic
1129309310 15:74694969-74694991 AAAAAAGATTAGGATCCATCTGG + Intronic
1129796209 15:78378568-78378590 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1130798110 15:87232373-87232395 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1130818570 15:87467121-87467143 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1132890039 16:2199350-2199372 AAAACAGATGTGTGTCTGCCTGG + Intergenic
1136600245 16:31281323-31281345 AATTCAGCTGTGAATCCGTCTGG + Intronic
1136855409 16:33652236-33652258 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1137051602 16:35718386-35718408 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1137808849 16:51333328-51333350 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1138151873 16:54665193-54665215 AATACAGCTGTGAATCCATCTGG - Intergenic
1138273660 16:55714879-55714901 AAAACAGTAGTGGATCAGACTGG - Intergenic
1139594741 16:67951066-67951088 AAAACAGATGAGACTCCCTCAGG + Intronic
1141071370 16:80958184-80958206 AATTCAGATGTGAATCCATCTGG - Intergenic
1203116995 16_KI270728v1_random:1500717-1500739 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1144364812 17:14532724-14532746 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1145716911 17:27032122-27032144 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1149174761 17:53856297-53856319 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1149674147 17:58443833-58443855 AAAAAACATGTGGTTACGTCTGG + Intronic
1153221156 18:2862825-2862847 AATACAGCTGTGAATCCATCTGG + Intronic
1153511480 18:5858659-5858681 AAATCAGCTGTGAATCCATCTGG + Intergenic
1153561921 18:6379921-6379943 AATTCAGCTGTGAATCCGTCTGG + Intronic
1153974443 18:10255264-10255286 AATTCAGCTGTGGATCTGTCTGG + Intergenic
1154288265 18:13081244-13081266 AATTCAGCTGTGAATCCGTCTGG + Intronic
1154416823 18:14179705-14179727 AAAACAGCTGAGGGTCCGTTTGG - Intergenic
1156026299 18:32658730-32658752 AATTCGGCTGTGGATCCGTCTGG - Intergenic
1157074043 18:44445539-44445561 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1158100312 18:53822443-53822465 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1158279118 18:55801407-55801429 AATTCGGCTGTGGATCCGTCTGG + Intergenic
1158398705 18:57101043-57101065 AATTCAGTTGTGAATCCGTCTGG + Intergenic
1158822463 18:61177425-61177447 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1159846868 18:73471371-73471393 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1159859394 18:73629585-73629607 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1160672135 19:370643-370665 AAAACTGATGTGAATACGCCGGG - Intronic
1163940305 19:20485968-20485990 AAACCAGCTGTGAATCTGTCTGG - Intergenic
1164110951 19:22158127-22158149 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1165262157 19:34628654-34628676 AAATCAGCTGTGAATCTGTCTGG - Intronic
1165983157 19:39743199-39743221 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
926941460 2:18141749-18141771 AATTCAGCTGTGAATCCGTCTGG + Intronic
926943653 2:18164817-18164839 AATTCAGCTGTGAATCCGTCTGG + Intronic
927046131 2:19280519-19280541 AATTCAGCTGTGAATCCGTCTGG + Intergenic
927610458 2:24534046-24534068 AATTCAGCTGTGAATCCGTCTGG + Intronic
928549003 2:32353872-32353894 AGAACAGATGTGGATTCTTAAGG + Intergenic
928766563 2:34653500-34653522 AATTCAGCTGTGAATCCGTCTGG - Intergenic
929086986 2:38177962-38177984 AAAACAAATGTGGATCAGGCAGG - Intergenic
929232873 2:39577620-39577642 AATTCAGCTGTGAATCCGTCTGG + Intergenic
929398977 2:41557903-41557925 AATTCAGCTGTGAATCCGTCTGG - Intergenic
929995094 2:46820891-46820913 AATTCAGCTGTGAATCCGTCTGG + Intronic
930143468 2:47977240-47977262 AATACGGCTGTGAATCCGTCTGG - Intergenic
930437271 2:51361297-51361319 AATTCAGCTGTGAATCCGTCTGG + Intergenic
930546121 2:52769317-52769339 AATTCAGCTGTGAATCCGTCTGG - Intergenic
930863187 2:56096080-56096102 AATTCAGCTGTGAATCCGTCTGG - Intergenic
930945348 2:57067331-57067353 AATTCAGCTGTGAATCCGTCTGG + Intergenic
931551507 2:63451481-63451503 AATTCAGCTGTGAATCCGTCTGG - Intronic
931815216 2:65893806-65893828 AAATCAGCTGTGAATCCATCTGG - Intergenic
931907270 2:66855863-66855885 AATTCAGCTGTGAATCCGTCTGG + Intergenic
932377247 2:71248038-71248060 AATTCAGCTGTGAATCCGTCTGG + Intergenic
933050528 2:77596219-77596241 AATTCAGCTGTGAATCCGTCTGG - Intergenic
933062661 2:77757153-77757175 AATTCAGCTGTGAATCCGTCTGG - Intergenic
933631619 2:84665637-84665659 AATTCAGCTGTGAATCCGTCTGG - Intronic
935453899 2:103243242-103243264 AACACAGATGAGGATCATTCTGG + Intergenic
936999635 2:118453903-118453925 AATTCAGCTGTGAATCCGTCTGG + Intergenic
937148175 2:119665537-119665559 AATACAGCTGTGAATCCATCTGG - Intergenic
937632667 2:124121023-124121045 ATAACAGATTTGGATCACTCAGG + Intronic
937644257 2:124248612-124248634 AAAACAGATGGGCATCAGTGAGG - Intronic
937857660 2:126684274-126684296 AAAGCACATGTGCATTCGTCTGG - Intronic
938138032 2:128775102-128775124 AAAGGAAATGTGGATGCGTCAGG + Intergenic
938167188 2:129040745-129040767 AATTCAGCTGTGAATCCGTCTGG + Intergenic
938915934 2:135940045-135940067 AATTCAGTTGTGAATCCGTCTGG - Intronic
939731137 2:145785903-145785925 AATTCAGCTGTGAATCCGTCTGG - Intergenic
940090519 2:149911199-149911221 AATTCAGCTGTGAATCCGTCTGG - Intergenic
940273002 2:151911780-151911802 AATTCAGCTGTGAATCCGTCTGG + Intronic
940946836 2:159627205-159627227 AATTCAGCTGTGAATCCGTCTGG - Intergenic
942392179 2:175507000-175507022 AATTCAGCTGTGAATCCGTCTGG - Intergenic
942722555 2:178969139-178969161 AATTCAGCTGTGAATCCGTCTGG - Intronic
942873892 2:180768617-180768639 AATTCAGCTGTGAATCCGTCTGG - Intergenic
943130284 2:183845445-183845467 AATTCAGCTGTGAATCCGTCTGG - Intergenic
943282845 2:185959708-185959730 AATTCAGCTGTGAATCCGTCAGG - Intergenic
943965334 2:194325875-194325897 AAAACAGCTTTGGATCAGTGAGG - Intergenic
944569315 2:201027351-201027373 AATTCAGCTGTGAATCCGTCTGG - Intronic
946887267 2:224234195-224234217 AATTCAGTTGTGAATCCGTCTGG + Intergenic
947132069 2:226938659-226938681 AATTCAGCTGTGAATCCGTCTGG - Intronic
947322224 2:228933068-228933090 AATTCAGCTGTGGATCCATCTGG + Intronic
948408089 2:237737891-237737913 AAAATAGAGGTGGATGGGTCTGG + Intronic
1170081187 20:12478492-12478514 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1170740962 20:19056148-19056170 AAAACTCATGTGGGTCCATCTGG + Intergenic
1170832542 20:19855485-19855507 AATTCAGTTGTGAATCCGTCTGG + Intergenic
1171434398 20:25108782-25108804 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1176587994 21:8608665-8608687 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1176856516 21:13979572-13979594 AAAACAGCTGAGGGTCCGTTTGG + Intergenic
1177092220 21:16783319-16783341 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1177365295 21:20127548-20127570 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1180254474 21:46615119-46615141 AATACAGCTGTGAATCCATCTGG + Intergenic
1180270826 22:10585664-10585686 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1182682720 22:32094444-32094466 AATTCAGCTGTGAATCCGTCTGG + Intronic
949155327 3:820021-820043 AAATCAGCTGTGAATCTGTCTGG - Intergenic
949286895 3:2417124-2417146 AAAGCAGATGTGCTTCTGTCTGG - Intronic
949800842 3:7902646-7902668 AATTCAGCTGTGAATCCGTCCGG + Intergenic
951005919 3:17615488-17615510 AATTCAGCTGTGAATCCGTCTGG + Intronic
951130688 3:19039770-19039792 AATTCAGCTGTGAATCCGTCTGG + Intergenic
951268183 3:20594511-20594533 AATTCAGCTGTGAATCCGTCTGG + Intergenic
951368607 3:21815717-21815739 AATTCAGCTGTGAATCCGTCTGG - Intronic
951795058 3:26529418-26529440 AATTCAGCTGTGAATCCGTCTGG + Intergenic
951801382 3:26600231-26600253 AAACCAGATGTGGATGGGTGTGG - Intergenic
952434956 3:33263955-33263977 AATTCAGCTGTGGATCCATCTGG + Intergenic
955122644 3:56076155-56076177 AAAACAGATGGCGATCTCTCTGG - Intronic
955635331 3:61022381-61022403 AATTCAGCTGTGGATCCATCTGG - Intronic
955667477 3:61365824-61365846 AATTCAGCTGTGAATCCGTCTGG - Intergenic
956973676 3:74555517-74555539 AATTCAGCTGTGAATCCGTCTGG + Intergenic
958155511 3:89751013-89751035 AATTCAGCTGTGAATCCGTCTGG - Intergenic
958423332 3:93953116-93953138 AATTCAGCTGTGAATCCGTCTGG - Intronic
958545986 3:95550872-95550894 AATTCAGCTGTGAATCCGTCTGG + Intergenic
959052519 3:101537814-101537836 AATTCGGCTGTGGATCCGTCTGG + Intergenic
959074859 3:101739207-101739229 AATTCAGCTGTGAATCCGTCTGG - Intronic
959218225 3:103480760-103480782 AATTCAGCTGTGGATCCGTCTGG + Intergenic
959495005 3:107039975-107039997 AATTCAGCTGTGAATCCGTCTGG - Intergenic
959725937 3:109541714-109541736 AATTCAGCTGTGAATCCGTCTGG - Intergenic
959778918 3:110204720-110204742 AATTCAGCTGTGAATCCGTCTGG - Intergenic
960212803 3:114990709-114990731 AATTCGGCTGTGGATCCGTCTGG + Intronic
960377773 3:116924605-116924627 AATTCAGCTGTGAATCCGTCTGG + Intronic
960476814 3:118140515-118140537 AATTCAGCTGTGAATCCGTCTGG + Intergenic
960828209 3:121814797-121814819 AATTCAGCTGTGAATCCGTCTGG - Intronic
960832059 3:121860274-121860296 AATTCAGCTGTGAATCCGTCTGG + Intronic
960835743 3:121904953-121904975 AATTCAGCTGTGAATCCGTCTGG + Intronic
962192159 3:133322558-133322580 AATTCAGCTGTGAATCCGTCTGG - Intronic
962287356 3:134098318-134098340 AATTCAGCTGTGAATCCGTCTGG + Intronic
962907682 3:139819954-139819976 AATTCAGCTGTGAATCCGTCTGG - Intergenic
963325710 3:143860662-143860684 AAATCAGCTGTGAATCCATCTGG + Intergenic
963551441 3:146729013-146729035 AATTCAGCTGTGAATCCGTCTGG - Intergenic
964183665 3:153916749-153916771 AATTCAGCTGTGAATCCGTCTGG - Intergenic
964900678 3:161655159-161655181 AATTCAGCTGTGAATCCGTCTGG + Intergenic
964911097 3:161781217-161781239 AAAAAAAATGTTGATCTGTCAGG - Intergenic
965511268 3:169570376-169570398 AATTCAGCTGTGAATCCGTCTGG - Intronic
966658509 3:182387146-182387168 AAAAAAGATGTGGATAAGTGTGG + Intergenic
970494629 4:16612739-16612761 AATTCAGCTGTGAATCCGTCCGG - Intronic
970666180 4:18339847-18339869 AATTCAGCTGTGAATCCGTCTGG + Intergenic
971508977 4:27400328-27400350 AATTCAGCTGTGGATCCATCTGG - Intergenic
972043568 4:34636351-34636373 AATTCAGCTGTGAATCCGTCTGG + Intergenic
972232442 4:37090571-37090593 AATTCAGCTGTGAATCCGTCTGG + Intergenic
972373153 4:38445395-38445417 AATTCAGCTGTGAATCCGTCTGG + Intergenic
972417010 4:38850767-38850789 AATTCAGCTGTGAATCCGTCTGG - Intronic
973027401 4:45290009-45290031 AATTCAGCTGTGGATCTGTCTGG + Intergenic
973556503 4:52088886-52088908 AATTCAGCTGTGAATCCGTCTGG + Intronic
974248250 4:59350767-59350789 AATACACATGTGGATCTCTCTGG - Intergenic
974619371 4:64336116-64336138 AATTCAGCTGTGAATCCGTCTGG + Intronic
975178242 4:71312309-71312331 AATTCAGCTGTGAATCCGTCAGG - Intronic
975292633 4:72695123-72695145 AATTCAGCTGTGAATCCGTCTGG - Intergenic
976957175 4:90915052-90915074 AATTCAGCTGTGAATCCGTCTGG - Intronic
977047219 4:92082507-92082529 AATTCAGCTGTGAATCCGTCTGG - Intergenic
977635801 4:99296801-99296823 AATTCAGCTGTGAATCCGTCTGG - Intergenic
978695171 4:111568655-111568677 AATTCAGCTGTGAATCCGTCTGG - Intergenic
978743129 4:112161696-112161718 AATTCAGCTGTGAATCCGTCTGG - Intronic
978845523 4:113268852-113268874 AATTCAGCTGTGAATCCGTCTGG + Intronic
979044000 4:115837777-115837799 AATTCAGCTGTGAATCCGTCTGG - Intergenic
979062524 4:116081120-116081142 AATTCAGCTGTGAATCCGTCTGG + Intergenic
979398673 4:120220597-120220619 AATTCAGCTGTGAATCCGTCTGG + Intergenic
979512553 4:121570840-121570862 AATTCAGCTGTGAATCCGTCTGG - Intergenic
979554653 4:122031260-122031282 AATTCAGCTGTGAATCCGTCTGG + Intergenic
980662011 4:135873028-135873050 AATTCAGCTGTGAATCCGTCTGG + Intergenic
980761135 4:137235637-137235659 AATTCAGCTGTGAATCCGTCTGG + Intergenic
980861565 4:138505077-138505099 AATTCAGCTGTGAATCCGTCTGG + Intergenic
981053676 4:140337835-140337857 AATTCAGCTGTGAATCCGTCTGG - Intronic
981257151 4:142675386-142675408 AAATCAGATGTAAATCTGTCTGG - Intronic
981514622 4:145593922-145593944 AATTCAGCTGTGAATCCGTCTGG + Intergenic
981795620 4:148591633-148591655 AATTCAGTTGTGAATCCGTCTGG + Intergenic
982880394 4:160706584-160706606 AATTCAGCTGTGAATCCGTCTGG + Intergenic
982908897 4:161114853-161114875 AATTCAGCTGTGAATCCGTCTGG + Intergenic
983005505 4:162479563-162479585 AAATCAGCTGTGAATCCATCTGG + Intergenic
983072472 4:163285160-163285182 AATTCAGCTGTGAATCCGTCTGG + Intergenic
983757305 4:171355868-171355890 AATTCAGCTGTGAATCCGTCTGG + Intergenic
984384116 4:179033453-179033475 AAATCAGCTGTGAATCCGTCTGG - Intergenic
984457299 4:179986461-179986483 AATTCAGCTGTGAATCCGTCTGG + Intergenic
984857972 4:184211625-184211647 AATTCAGCTGTGAATCCGTCTGG - Intronic
986845961 5:11753774-11753796 AACTCAGATGTGAATCCATCTGG + Intronic
987086031 5:14468679-14468701 AAAACACATGTGGATGCTTAAGG - Intronic
987157117 5:15100178-15100200 AATTCAGCTGTGAATCCGTCTGG - Intergenic
987275608 5:16359126-16359148 AATTCAGCTGTGAATCCGTCTGG + Intergenic
988355437 5:30167916-30167938 AATTCAGCTGTGGATCCATCTGG - Intergenic
988506160 5:31825214-31825236 AATCCAGATGTGGTTCCGTTTGG - Intronic
989324023 5:40169232-40169254 AATTCAGCTGTGGATCCATCTGG - Intergenic
990038568 5:51352195-51352217 AATTCAGCTGTGAATCCGTCTGG - Intergenic
990069221 5:51758099-51758121 AATTCAGCTGTGAATCCGTCTGG + Intergenic
990721055 5:58696525-58696547 AATTCAGCTGTGAATCCGTCTGG + Intronic
990867914 5:60400189-60400211 AAAACAGAAGTGGATGGGACTGG + Intronic
991046447 5:62227935-62227957 AATTCAGCTGTGAATCCGTCTGG + Intergenic
991223896 5:64246648-64246670 AATTCAGATGTGAATCCATCTGG - Intronic
991574448 5:68088340-68088362 AAAACAGATGTGCACCCTTTTGG + Intergenic
992183157 5:74217981-74218003 AATTCAGCTGTGAATCCGTCTGG - Intergenic
992383509 5:76262048-76262070 AATTCAGCTGTGAATCCGTCTGG + Intronic
993341333 5:86728441-86728463 AATTCGGATGTGAATCCGTCTGG + Intergenic
993445911 5:88012074-88012096 AATTCAGATGTGAATCCATCTGG + Intergenic
993471164 5:88309267-88309289 AATTCAGTTGTGAATCCGTCTGG - Intergenic
995811370 5:116110469-116110491 AATTCAGCTGTGAATCCGTCTGG + Intronic
995821946 5:116245381-116245403 AATTCAGATGTGAATACGTCTGG - Intronic
996320281 5:122207937-122207959 AATTCAGCTGTGAATCCGTCTGG - Intergenic
996854630 5:127991379-127991401 AATTCAGCTGTGAATCCGTCTGG + Intergenic
996894159 5:128459338-128459360 AATTCAGCTGTGAATCCGTCTGG - Intronic
999337797 5:150738156-150738178 AAATCAGCTGTGAATCCATCTGG - Intronic
999659895 5:153849981-153850003 AATATAGCTGTGAATCCGTCTGG + Intergenic
1000557332 5:162742127-162742149 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1000746724 5:165043060-165043082 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1001983662 5:176055268-176055290 AATTCAGCTGTGAATCCGTCTGG - Intronic
1002615133 5:180448280-180448302 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1003686712 6:8311594-8311616 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1003820028 6:9885836-9885858 AATTCAGCTGTGAATCCGTCTGG - Intronic
1006199248 6:32272013-32272035 AACTCAGTTGTGAATCCGTCTGG - Intergenic
1008431463 6:51422519-51422541 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1008633540 6:53386572-53386594 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1010812128 6:80313032-80313054 AAATCAGCTGTGAATCCATCTGG + Intronic
1011383343 6:86766630-86766652 AAAACAGATGGGTGTACGTCAGG + Intergenic
1011619849 6:89232628-89232650 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1011784529 6:90829145-90829167 AAAATGGAGGAGGATCCGTCCGG + Intergenic
1011893013 6:92190986-92191008 AAATCTGATGTGAATCCATCTGG + Intergenic
1012267062 6:97157923-97157945 AAATCAGTTGTGAATCTGTCTGG + Intronic
1012298964 6:97560581-97560603 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1012434509 6:99200984-99201006 AAATCAGCTGTGAATCTGTCTGG + Intergenic
1012941306 6:105418546-105418568 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1013025359 6:106266382-106266404 AATTCAGCTGTGAATCCGTCTGG - Intronic
1013381591 6:109577584-109577606 AAATCAGCTGTGAATCCATCTGG + Intronic
1013848331 6:114482322-114482344 AATTCAGATGTGAATCCATCTGG - Intergenic
1013973102 6:116044122-116044144 AATTCAGCTGTGAATCCGTCTGG - Intronic
1014063296 6:117097871-117097893 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1014306143 6:119744839-119744861 CAAACAGATCTGGATCCTTAAGG + Intergenic
1014519959 6:122430111-122430133 AATTCAGCTGTGAATCCGTCTGG + Intronic
1014810942 6:125884943-125884965 AAAACAGATGTGGCTCACTGAGG - Intronic
1014890591 6:126839403-126839425 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1017094886 6:150796059-150796081 CACCCAGATATGGATCCGTCTGG + Intronic
1017226846 6:152031677-152031699 AATTCAGCTGTGAATCCGTCTGG - Intronic
1020959808 7:14788193-14788215 AAAACAGATCTGTTTGCGTCTGG + Intronic
1021064943 7:16161789-16161811 AAATCAGCTGTGACTCCGTCTGG + Intronic
1022079435 7:27005046-27005068 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1022986732 7:35662478-35662500 AATTCAGCTGTGAATCCGTCTGG + Intronic
1023238638 7:38117886-38117908 AATTCAGGTGTGAATCCGTCTGG + Intergenic
1023498311 7:40821368-40821390 AATTCAGCTGTGAATCCGTCTGG + Intronic
1023650895 7:42368039-42368061 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1024016306 7:45318804-45318826 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1024560005 7:50635925-50635947 AAAAAAGCTGTGGATCCATCTGG - Intronic
1024875950 7:54023452-54023474 AATTCAGATGTGAATCCATCTGG + Intergenic
1024946826 7:54816604-54816626 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1026429584 7:70331152-70331174 AATTCAGCTGTGAATCCGTCTGG + Intronic
1028100057 7:86808350-86808372 AATTCAGCTGTGAATCCGTCTGG + Intronic
1028316466 7:89408523-89408545 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1028821580 7:95217574-95217596 AATTCAGCTGTGAATCCGTCTGG + Intronic
1031311914 7:120209306-120209328 AATTCAGTTGTGGATCCATCTGG - Intergenic
1031699346 7:124904053-124904075 AATTCAGCTGTGGATCTGTCTGG - Intronic
1032764651 7:134979529-134979551 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1033831212 7:145255570-145255592 AAAACAGATGTTGATGAGGCTGG - Intergenic
1034331832 7:150289424-150289446 AAAACAGATGGGAAACCGGCTGG - Intronic
1034666204 7:152820446-152820468 AAAACAGATGGGAAACCGGCCGG + Intronic
1034714779 7:153231607-153231629 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1035599166 8:886004-886026 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1036920916 8:12854485-12854507 AATACAGATGTGGTTGCGTCCGG + Intergenic
1037557342 8:20037923-20037945 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1037664861 8:20959748-20959770 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1038377811 8:27060448-27060470 AATTCAGCTGTGAATCCGTCCGG + Intergenic
1041221849 8:55659681-55659703 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1041275056 8:56148747-56148769 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1041583636 8:59491738-59491760 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1041772169 8:61483479-61483501 AATTCAGCTGTGAATCCGTCTGG - Intronic
1042698543 8:71585139-71585161 AATTCAGATGTGAATCCATCTGG - Intronic
1042853202 8:73237456-73237478 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1042897113 8:73682999-73683021 AATTCAGCTGTGAATCCGTCTGG - Intronic
1043272683 8:78354034-78354056 AATTCAGCTGTGGATCCATCTGG - Intergenic
1043339723 8:79222930-79222952 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1043362897 8:79496339-79496361 AAATCAGCTGTGAATCCGTCAGG + Intergenic
1043381911 8:79711576-79711598 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1043411966 8:80006808-80006830 AATTCAGCTGTGAATCCGTCTGG - Intronic
1043535709 8:81202019-81202041 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1043642122 8:82467479-82467501 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1043757125 8:84017476-84017498 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1044227891 8:89740067-89740089 AATTCTGATGTGAATCCGTCTGG - Intergenic
1045671298 8:104556652-104556674 AATTCAGCTGTGAATCCGTCTGG - Intronic
1045829581 8:106442519-106442541 AATTCAGCTGTGAATCCGTCTGG + Intronic
1045867353 8:106883263-106883285 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1046394866 8:113628658-113628680 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1046408280 8:113803719-113803741 AAAACAGATGTGGAAGCCTATGG - Intergenic
1046791466 8:118326685-118326707 AAAACATATGTGGGTCCTGCAGG - Intronic
1047062065 8:121238492-121238514 AAAACAGATGCGGAGCAGTCAGG + Intergenic
1047890174 8:129299839-129299861 AATTCAGCTGTGGATCCATCTGG + Intergenic
1048149498 8:131880303-131880325 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1050305915 9:4305852-4305874 AAATCAGGTGTGGTTCCATCAGG - Intronic
1050368701 9:4898680-4898702 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1050390893 9:5143296-5143318 AATTCAGCTGTGAATCCGTCTGG + Intronic
1050632657 9:7577021-7577043 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1050969033 9:11845368-11845390 TAAACAGATTTTTATCCGTCTGG - Intergenic
1051451362 9:17201438-17201460 AATTCAGCTGTGAATCCGTCTGG + Intronic
1051970847 9:22885679-22885701 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1052326808 9:27224148-27224170 AATTCAGCTGTGGATCCGTCTGG - Intronic
1054527816 9:66152523-66152545 AAAACAGATGAGAGTCCGTTTGG + Intronic
1055085472 9:72309248-72309270 AAAACAGATGTGCCCCCGTGAGG - Intergenic
1055276245 9:74620146-74620168 AATTCAGCTGTGAATCCGTCTGG + Intronic
1058233881 9:102464893-102464915 AATACAGTTGTGAATCCATCTGG - Intergenic
1059594714 9:115707179-115707201 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1060263486 9:122095146-122095168 AAAACAAATGCGGCTCCCTCAGG - Intergenic
1061446153 9:130639304-130639326 AAAGCAGCTGTGGCTCCTTCAGG + Intergenic
1203617999 Un_KI270749v1:87253-87275 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1186783093 X:12933119-12933141 AAATCAGCTGTAAATCCGTCTGG - Intergenic
1186964119 X:14769266-14769288 AATTCAGCTGTGAATCCGTCGGG + Intergenic
1187628135 X:21139873-21139895 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1187839619 X:23473591-23473613 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1188628081 X:32312973-32312995 AATTCAGCTGTGAATCCGTCTGG - Intronic
1188771478 X:34159113-34159135 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1188916634 X:35919756-35919778 AAAACAGATGTGGATCCGTCCGG - Exonic
1189243720 X:39545959-39545981 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1191097157 X:56685610-56685632 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1191146990 X:57177509-57177531 AAAACAAATGTGGGTCGGTTCGG + Intergenic
1191177772 X:57523699-57523721 AATTCAGCTGTGGATTCGTCTGG + Intergenic
1191188213 X:57636208-57636230 AATACAGCTGTGAATCCATCTGG - Intergenic
1191198212 X:57747656-57747678 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1192524872 X:71833484-71833506 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1192843918 X:74885685-74885707 AATTCAGCTGTGAATCCGTCTGG - Intronic
1192948829 X:75994735-75994757 AATTCAGATGTGAATCCATCTGG + Intergenic
1192976877 X:76295772-76295794 AATTCAGCTGTGGATCAGTCTGG + Intergenic
1193039612 X:76990865-76990887 AATTCAGATGTGAATCTGTCTGG - Intergenic
1193361388 X:80583472-80583494 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1193434272 X:81452778-81452800 AATTCAGATGTGAATCCGTCTGG - Intergenic
1193479098 X:82004832-82004854 AATTCAGTTGTGAATCCGTCTGG + Intergenic
1193754255 X:85387583-85387605 AAATCAGCTGTGAATCCATCTGG - Intergenic
1193775705 X:85638837-85638859 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1193835568 X:86339103-86339125 AATTCAGCTGTGAATCCGTCTGG - Intronic
1193907085 X:87257123-87257145 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1193922418 X:87445721-87445743 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1194342210 X:92719050-92719072 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1194602384 X:95938335-95938357 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1194792649 X:98169799-98169821 AAAAAAGCAGTGGATCCGACTGG - Intergenic
1195391112 X:104363244-104363266 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1195855908 X:109332422-109332444 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1195970663 X:110469702-110469724 AAATCAGCTGTGAATCCATCTGG + Intergenic
1195987135 X:110642622-110642644 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1197180576 X:123531611-123531633 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1197417025 X:126187827-126187849 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1197886202 X:131220929-131220951 AAAACAAATGTGACTCCATCAGG - Intergenic
1198072468 X:133162893-133162915 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1198660062 X:138958625-138958647 AATTCAGCTGTGAATCCGTCTGG + Intronic
1198942989 X:141978832-141978854 AATTCAGATGTGAATCCCTCTGG + Intergenic
1199275940 X:145941963-145941985 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1200378773 X:155812331-155812353 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1200650567 Y:5835745-5835767 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1201651989 Y:16298937-16298959 AATCCAGATGTGAATCTGTCTGG - Intergenic
1201740145 Y:17315162-17315184 AATTCAGCTGTGAATCCGTCGGG - Intergenic
1201740747 Y:17322367-17322389 AATTCAGCTGTGAATCCGTCGGG + Intergenic
1201775893 Y:17665292-17665314 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1201825663 Y:18240700-18240722 AATTCAGCTGTGAATCCGTCTGG - Intergenic
1202341859 Y:23877920-23877942 AATTCAGCTGTGAATCCGTCTGG + Intergenic
1202528908 Y:25792166-25792188 AATTCAGCTGTGAATCCGTCTGG - Intergenic