ID: 1188916634

View in Genome Browser
Species Human (GRCh38)
Location X:35919756-35919778
Sequence AAAACAGATGTGGATCCGTC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 476
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 464}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188916634_1188916638 -7 Left 1188916634 X:35919756-35919778 CCGGACGGATCCACATCTGTTTT 0: 1
1: 0
2: 0
3: 11
4: 464
Right 1188916638 X:35919772-35919794 CTGTTTTCTGGCTACCGAGAGGG 0: 1
1: 0
2: 1
3: 11
4: 99
1188916634_1188916641 15 Left 1188916634 X:35919756-35919778 CCGGACGGATCCACATCTGTTTT 0: 1
1: 0
2: 0
3: 11
4: 464
Right 1188916641 X:35919794-35919816 GCAGCCATGAACACCCAAAAGGG 0: 1
1: 0
2: 2
3: 14
4: 182
1188916634_1188916637 -8 Left 1188916634 X:35919756-35919778 CCGGACGGATCCACATCTGTTTT 0: 1
1: 0
2: 0
3: 11
4: 464
Right 1188916637 X:35919771-35919793 TCTGTTTTCTGGCTACCGAGAGG 0: 1
1: 0
2: 0
3: 9
4: 117
1188916634_1188916640 14 Left 1188916634 X:35919756-35919778 CCGGACGGATCCACATCTGTTTT 0: 1
1: 0
2: 0
3: 11
4: 464
Right 1188916640 X:35919793-35919815 GGCAGCCATGAACACCCAAAAGG 0: 1
1: 0
2: 0
3: 10
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188916634 Original CRISPR AAAACAGATGTGGATCCGTC CGG (reversed) Exonic