ID: 1188916934

View in Genome Browser
Species Human (GRCh38)
Location X:35922935-35922957
Sequence AGGTGGAGAAGAAGCGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1216
Summary {0: 1, 1: 0, 2: 10, 3: 79, 4: 1126}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188916934_1188916940 7 Left 1188916934 X:35922935-35922957 CCTTCCTCGCTTCTTCTCCACCT 0: 1
1: 0
2: 10
3: 79
4: 1126
Right 1188916940 X:35922965-35922987 CCATTCTCTAAGACTAGGCCAGG 0: 1
1: 0
2: 1
3: 8
4: 110
1188916934_1188916938 2 Left 1188916934 X:35922935-35922957 CCTTCCTCGCTTCTTCTCCACCT 0: 1
1: 0
2: 10
3: 79
4: 1126
Right 1188916938 X:35922960-35922982 AATATCCATTCTCTAAGACTAGG 0: 1
1: 0
2: 0
3: 17
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188916934 Original CRISPR AGGTGGAGAAGAAGCGAGGA AGG (reversed) Intronic
900183481 1:1322597-1322619 GGGAGGAGAAGAAGCGGGGCGGG + Intronic
900204825 1:1427383-1427405 AGGGGGAGAAGAGGGGAGCAGGG - Intronic
900627225 1:3613970-3613992 AGGTGGAGAGGCAGGCAGGAAGG + Intergenic
900670764 1:3852938-3852960 AGGTTAGGAAGAAGCCAGGAGGG + Intronic
900701238 1:4049781-4049803 AGGGGGAGAAAGAGGGAGGAAGG + Intergenic
900863071 1:5246461-5246483 AGGGAGAGAGGAAGGGAGGAGGG - Intergenic
901123813 1:6915495-6915517 AGGAAGAGAAGAAGCCAGGCCGG + Intronic
901128059 1:6943190-6943212 AGGAGGAGAAGAGGGGAGGAAGG - Intronic
901130927 1:6962370-6962392 AGGGGGAGTGGAAGGGAGGAGGG - Intronic
901411645 1:9088344-9088366 AGGTGGAGAAGGAGGAGGGAGGG - Intronic
901975576 1:12941647-12941669 AGAGGGAGAAGAAGCAGGGAGGG - Intronic
902688912 1:18097376-18097398 AGGGAGAGAAGGAGGGAGGAAGG - Intergenic
902752074 1:18523630-18523652 AGGGAGAGAAGAAGAAAGGAAGG - Intergenic
903031607 1:20467719-20467741 AGGAAGAGAAGCAGAGAGGATGG - Intergenic
903331782 1:22600302-22600324 AAGAGGAAAAGAAGGGAGGAAGG + Intronic
903548468 1:24141676-24141698 AGGAGGAAAAGGAGCGAGGAGGG - Intronic
903751254 1:25622336-25622358 AGGTGGAAGAGAAGAGAGAAGGG - Intronic
903837750 1:26216671-26216693 AGGTGGGGGAGAAGCTGGGAAGG - Intergenic
904016883 1:27428528-27428550 AGGTGGAGGGGGAGGGAGGAGGG + Intronic
904087179 1:27917083-27917105 AGGAGGAGGAGGAGGGAGGAAGG - Intergenic
904128704 1:28260151-28260173 AGGGGGAGAGGGAGGGAGGAGGG - Intronic
904418216 1:30375566-30375588 AGGTGGAGAAGTGGGGAGGCTGG - Intergenic
904418230 1:30375620-30375642 AGGTGGAGAAGTGGGGAGGCTGG - Intergenic
904418258 1:30375729-30375751 AGGTGGAGAAGTGGGGAGGCTGG - Intergenic
904418285 1:30375835-30375857 AGGTGGAGAAGTGGGGAGGCTGG - Intergenic
904418327 1:30375999-30376021 AGGTGGAGAAGTGGGGAGGCTGG - Intergenic
904418340 1:30376053-30376075 AGGTGGAGAAGTGGGGAGGCTGG - Intergenic
904479557 1:30785445-30785467 TGGTGGAGAAGAGGCTTGGAAGG - Intergenic
904970763 1:34417927-34417949 AGGTGGAGGAGAAGGGAGATGGG + Intergenic
905277703 1:36829678-36829700 GGGAGGAGGAGAAGCCAGGAGGG - Intronic
905278712 1:36835516-36835538 ATGTGGAGAAGGAAGGAGGAAGG - Intronic
905404834 1:37725710-37725732 GGGTGGAGATGAAGGGGGGAAGG + Intronic
906480744 1:46197643-46197665 AGGTGGGGAGGAAGCTGGGAGGG + Intronic
906735818 1:48126045-48126067 AAGTGGAGAGGGAGGGAGGAAGG + Intergenic
907334629 1:53692134-53692156 AGGTGGGGAAAAAGAGAGGTTGG - Intronic
907553801 1:55327251-55327273 AGGTGGAGAAGGAGGGAAGAAGG + Intergenic
907834840 1:58098965-58098987 AGGTGGAGAAGAAGAGACAGAGG + Intronic
908032052 1:60011424-60011446 AGGGAGGGAAGAAGGGAGGAAGG - Intronic
908287304 1:62621106-62621128 AGGAGGAGAAGAAGGAAGAAAGG + Intronic
908462306 1:64357380-64357402 AGGAAGAGAGGAAGGGAGGAAGG - Intergenic
908858792 1:68459858-68459880 AGGAAGGGAAGAAGGGAGGAAGG - Intergenic
908858797 1:68459874-68459896 AGGAAGAGAGGAAGGGAGGAAGG - Intergenic
908858800 1:68459882-68459904 AGGAAGAGAGGAAGAGAGGAAGG - Intergenic
908936019 1:69376505-69376527 AGGAGGAGAGGAAGGAAGGAAGG + Intergenic
909814821 1:79978579-79978601 TGGTGGTGAAGAAGAGAGGTGGG - Intergenic
909927616 1:81456940-81456962 AGGAAGAGAAGAAGAGAGGAAGG - Intronic
911708590 1:101043040-101043062 AGGGAGGGAAGAAGGGAGGAAGG - Intergenic
912000435 1:104827173-104827195 AAATGGAAAAGAAGGGAGGAAGG - Intergenic
912114991 1:106394745-106394767 TGCTGGAGAAGAGGGGAGGAAGG - Intergenic
912474440 1:109926650-109926672 AGGTTGTGGAGAAGCCAGGAAGG - Intronic
912897902 1:113612450-113612472 AGGAGGATGAGAAGGGAGGAAGG + Intronic
914711806 1:150221466-150221488 AGGAAGAGAGGAAGAGAGGAAGG + Intronic
914814090 1:151050356-151050378 AGGGGGAGATGAAGCAAGGAAGG + Intronic
915029124 1:152861058-152861080 AGGAGGAGAAGGAAGGAGGAGGG - Intergenic
915035320 1:152918759-152918781 AGGAGGAGGAGGAGGGAGGAGGG + Intergenic
915426765 1:155833749-155833771 AGGAGGGGAGGAAGGGAGGAGGG + Intronic
916087292 1:161280780-161280802 GGATGGAGAAGAAGCCAGGTAGG - Intronic
916422602 1:164650875-164650897 AGGAGGAAAAGAAGGGAGAAGGG - Intronic
916446953 1:164881323-164881345 AGGAGGAAAAGAAGGAAGGAAGG + Intronic
916446961 1:164881359-164881381 AGGAGGAAAAGAAGGAAGGAAGG + Intronic
916446969 1:164881395-164881417 AGGAGGAAAAGAAGGTAGGAAGG + Intronic
916844988 1:168641551-168641573 AGGTCGGGAAGAAACCAGGAAGG - Intergenic
916881587 1:169024325-169024347 AGGAGGAGGAGAAGGAAGGAAGG + Intergenic
917121902 1:171652132-171652154 AGGAAGAGAAGAAGCGACTAAGG - Exonic
917132205 1:171754780-171754802 AGGAAGGGAAGAGGCGAGGAAGG + Intergenic
917149912 1:171932087-171932109 AGGAAGGGAAGAAGGGAGGAAGG - Intronic
917231696 1:172844799-172844821 AGGAAGAGAAGAAGAAAGGAAGG + Intergenic
917779034 1:178371567-178371589 AGGAGGAGGAGAAGAAAGGAGGG + Intronic
917806569 1:178618948-178618970 AGGGAGGGAAGAAGGGAGGAAGG + Intergenic
918206018 1:182310082-182310104 AGGTGGTGAAGAAGCAGGGTAGG + Intergenic
918920912 1:190708706-190708728 AGGTAGGGAAGAAGGGAGGGGGG - Intergenic
919055573 1:192565766-192565788 AGGTGGAGAGGGAGGAAGGAAGG + Intergenic
919348021 1:196411117-196411139 AGGTAGGAAAGAAGGGAGGAAGG - Intronic
919493506 1:198235369-198235391 AGGGGGAAAAGAAGGGAGGGTGG - Intronic
919631851 1:199966976-199966998 AAATGGAGAAGAAGCCAGGTAGG + Intergenic
919675887 1:200382660-200382682 AGCTGGAGAAGAATGGAGGTGGG - Intergenic
919739939 1:200975317-200975339 GGGTAGGGAAGAAGGGAGGATGG + Intronic
919887367 1:201944677-201944699 AGAGGGAGAAGGAGGGAGGAAGG - Intronic
920009895 1:202860126-202860148 AGGACCAGAAGAAGGGAGGAAGG - Intergenic
920073262 1:203318536-203318558 AGGAGGAGAGGAAGGAAGGAAGG - Intergenic
920089557 1:203442547-203442569 AGGGAGAGAAGAAGGGAGGCAGG - Intergenic
920092428 1:203464131-203464153 AGGAGGAGGAGGAGGGAGGAAGG + Intergenic
920188269 1:204175978-204176000 AGGAGGAGGAGAAGGAAGGAGGG - Intergenic
920437292 1:205955590-205955612 AGGAAGAAAAGAAGCAAGGAAGG + Intergenic
920667342 1:207972636-207972658 AGGAGGAGATGAAGGGAGCATGG + Intergenic
920779862 1:208978752-208978774 GGCTGGAGAAGTAGGGAGGAAGG + Intergenic
921266877 1:213428366-213428388 AGGTAAAAAAGAAGAGAGGAAGG - Intergenic
921404854 1:214767508-214767530 AGGAAGGGAAGAAGCAAGGAAGG - Intergenic
921575641 1:216831543-216831565 AGAGGGAGAGGAAGGGAGGAAGG + Intronic
921771918 1:219050528-219050550 AGGGGGAGATGGAGGGAGGAAGG + Intergenic
921852030 1:219941516-219941538 AGGAAGGGAAGAAGAGAGGAAGG - Intronic
921852047 1:219941588-219941610 AGGAAGGGAAGAAGAGAGGAAGG - Intronic
922595902 1:226812689-226812711 AGGGAGAGAAGAAGGAAGGAAGG - Intergenic
922807806 1:228399559-228399581 AGGTGTTGGAGAAGCCAGGAAGG - Intronic
923051744 1:230394976-230394998 GGGAGGAGAGGAAGGGAGGAAGG - Intronic
923127749 1:231047255-231047277 AGGAGGAAATGAAGGGAGGAAGG - Intergenic
923210510 1:231799900-231799922 AGGAAGGGAAGAAGGGAGGAAGG - Intronic
923684762 1:236146372-236146394 GGGTGGGGAGGAAGAGAGGATGG + Intronic
923712015 1:236395454-236395476 AGGAGGAGAAGAAGAAGGGAGGG + Intronic
924156985 1:241187951-241187973 AGGGAGAGATGAAGAGAGGATGG + Intronic
924448520 1:244156816-244156838 AGGGAGAGAGGAAGAGAGGAAGG - Intergenic
924537824 1:244952513-244952535 AGGGAGAGAGGAAGGGAGGAAGG + Intergenic
924608667 1:245556292-245556314 AGGAGGAGGAGGAGGGAGGAAGG - Intronic
924608678 1:245556338-245556360 AGGAGGAGGAGGAGGGAGGAAGG - Intronic
924633475 1:245763575-245763597 GGGTGGAAAGGAAGAGAGGAAGG + Intronic
924695140 1:246391472-246391494 AGGGAGAGAAGGAGAGAGGAGGG + Intronic
1062846027 10:706281-706303 AGAAGGAGAAGAAGGGAGGTGGG - Intergenic
1062849548 10:733155-733177 AGGGAGAGAGGAAGGGAGGAGGG - Intergenic
1063044106 10:2373917-2373939 AGGGAGAGAGGAAGAGAGGAAGG - Intergenic
1063407810 10:5813445-5813467 AGGAGGGGAGGGAGCGAGGAGGG + Exonic
1063917837 10:10902788-10902810 GGGAGGAGAGGAAGTGAGGAAGG + Intergenic
1063999828 10:11654226-11654248 AGGAGGAGAGGAAGGAAGGAAGG + Intergenic
1064493500 10:15884675-15884697 AGGACGAGAAGAAGGGAGGGAGG - Intergenic
1064596845 10:16953905-16953927 AGGGGAAGAAGAGGGGAGGAAGG + Intronic
1064635242 10:17358596-17358618 AGGAGGAGAAGGAGGGAGGAAGG + Intronic
1065639805 10:27770310-27770332 AGGGAGAGAAGAAGGGAGGGAGG - Intergenic
1066010927 10:31192805-31192827 AGGAGGAAAAGAAGGAAGGAAGG - Intergenic
1066021063 10:31302715-31302737 AGGGAGGGAAGAAGGGAGGATGG - Intergenic
1066274846 10:33858548-33858570 AGGGGGAGAAAATGGGAGGAAGG - Intergenic
1067180902 10:43985293-43985315 AGGTGGAGGAGCTGCGAGGGAGG - Intergenic
1067238279 10:44469697-44469719 TGGAGGAGAAGAGGCGTGGAAGG + Intergenic
1067565150 10:47331066-47331088 AGGTGGAGAAGAGCCTAGGGAGG - Intergenic
1068025988 10:51644772-51644794 AGGAAGGGAGGAAGCGAGGAAGG - Intronic
1068987227 10:63118588-63118610 AGGAGGAAAAGGAGCCAGGATGG - Intergenic
1069219379 10:65864511-65864533 AGGTTTAGAGGAAACGAGGAGGG + Intergenic
1069333478 10:67321000-67321022 GGGTGGAGCAGGAGGGAGGATGG - Intronic
1069668747 10:70183628-70183650 AGGAGGAGAAGGAGGAAGGAAGG + Intergenic
1069786987 10:70994746-70994768 AGGTGGAGGAGAGGAGAGGGTGG + Intergenic
1069919637 10:71808654-71808676 AGATGGAGAAGAAGGGGGAAGGG - Intronic
1070273426 10:74980769-74980791 AGGTGGAGAAAAAGTCAGCAGGG + Intronic
1070312491 10:75283724-75283746 AGGAGGAGGAGAAGAAAGGAGGG + Intergenic
1070603669 10:77883280-77883302 AGGTAGGGAAGAATGGAGGATGG + Intronic
1070680732 10:78447336-78447358 AGGTGGAGAAGCAGCAAGGAAGG + Intergenic
1071160493 10:82740188-82740210 AGGAAGAGAGGAAGGGAGGAAGG - Intronic
1071189020 10:83079044-83079066 AGGTGGAGAAGACAGGAGCAAGG - Intergenic
1071207827 10:83302407-83302429 TGATGGGGAAGAAGAGAGGAGGG - Intergenic
1071483791 10:86084335-86084357 AGGGAGAGAGGAAGAGAGGAAGG + Intronic
1071497356 10:86178372-86178394 AGGGGGAGAAGAAGCAAGGCTGG + Intronic
1071728257 10:88221111-88221133 AGGTAGAGAGGAAGAAAGGAGGG - Intergenic
1072253931 10:93602502-93602524 AGATGGAGAAGCAGGGGGGAAGG - Intronic
1072300100 10:94052348-94052370 AGAAGGAGAAGTAGGGAGGAGGG - Intronic
1072310320 10:94148211-94148233 AAGTGGAGATGGAGCGAAGAAGG + Intronic
1072316171 10:94205407-94205429 AGGTGGGGAGGAAGAGAGAATGG + Intronic
1072757164 10:98029334-98029356 AAGTGGAAAAGAAGGGAAGAGGG - Intronic
1073055330 10:100696518-100696540 AGGGAGAGAAGGAGGGAGGAAGG + Intergenic
1073169332 10:101490196-101490218 AGGGAGGGAAGAAGGGAGGAAGG - Intronic
1073753945 10:106560638-106560660 AGATGGAGCAGAAAAGAGGACGG - Intergenic
1073835438 10:107435816-107435838 ACGTGGAGGAGAAGAGGGGAGGG + Intergenic
1074252435 10:111764662-111764684 TGGTGGAGACGAAGCCTGGATGG - Intergenic
1074606377 10:114972724-114972746 AGGTGGTGAAGAAGGGAGTGAGG - Intronic
1074741388 10:116487568-116487590 AAGTGGAGAAGACCCCAGGAGGG - Intergenic
1075153250 10:119953741-119953763 AGGAAGAGAGGAAGGGAGGAAGG - Intergenic
1075495275 10:122914436-122914458 GGGAGCAGAAGAAGCGAGGGAGG - Intergenic
1075619452 10:123915070-123915092 AGGCGGGGGAGAAGTGAGGAAGG - Intronic
1075695971 10:124435550-124435572 ATGTGCAAAAGAAGAGAGGATGG + Intergenic
1075715316 10:124551995-124552017 AGGTGGAGAAGGGGAGGGGATGG - Intronic
1076179553 10:128396481-128396503 GGGTGGTGAAGAAGTGAGGGTGG + Intergenic
1076196533 10:128522524-128522546 AGGTGAACAAGAAGCAAGGCAGG + Intergenic
1076518504 10:131063442-131063464 AGGTTGAGCAGAAGCCAGCAAGG - Intergenic
1076566037 10:131400239-131400261 AGATGCAGAAGCAGTGAGGATGG + Intergenic
1076631412 10:131854349-131854371 AGGTGGGGGAGAAGCTGGGAAGG + Intergenic
1076738303 10:132468442-132468464 AGGAGGAGAAGAAGCTGGAAAGG + Intergenic
1076908423 10:133374921-133374943 AGGTGAAGGAGAAGGAAGGAAGG - Intergenic
1076989856 11:267356-267378 AGGAGGGGGAGGAGCGAGGAGGG + Intergenic
1077272222 11:1686735-1686757 AGGCAGAGAAGGAGGGAGGAGGG - Intergenic
1077354041 11:2106546-2106568 AGGAAGAGAAGAAGGGAGGGAGG + Intergenic
1077491715 11:2863864-2863886 AGGAGGAGGAGGAGGGAGGAGGG + Intergenic
1077526583 11:3069452-3069474 AGGGAGAGAGGAAGGGAGGAAGG + Intergenic
1077903984 11:6514524-6514546 AGGGAGAGAAAAAGGGAGGAAGG - Intronic
1077924426 11:6666692-6666714 AGGGAGAGAAGGAGGGAGGAAGG - Intergenic
1078156822 11:8806943-8806965 AAGTGGAGAAGGGGCCAGGAGGG - Intronic
1078256365 11:9662604-9662626 TGGTGGGGAAGAGGAGAGGATGG - Intergenic
1078469511 11:11575764-11575786 AAGAGGAAAAGAAGGGAGGAAGG + Intronic
1078531782 11:12142140-12142162 GGGTGGAGGAGAAAAGAGGAAGG - Intronic
1078877794 11:15415462-15415484 AGTGGGAGGAGAAGGGAGGAGGG + Intergenic
1078923238 11:15850929-15850951 AGGAGGAGAAGCAGAGAGAAAGG - Intergenic
1079224017 11:18589309-18589331 AGTTGGAAAACAAGAGAGGAGGG + Intergenic
1079614493 11:22474491-22474513 AAGTGGAGAAGAACAGAAGAAGG + Intergenic
1079917639 11:26390388-26390410 AGATGGAGGAGAAGAGAAGAAGG - Intronic
1079944620 11:26726212-26726234 AGAGGGAGAAGAAGGAAGGAAGG - Intergenic
1080174742 11:29349076-29349098 AGGAGGAGAAGGAGAGGGGAAGG + Intergenic
1080313546 11:30922999-30923021 AGGTGGGAAAGAAGGGAGCAAGG + Intronic
1080748008 11:35126500-35126522 AGTTGGAGAGGAAGGGAGAATGG - Intergenic
1081264749 11:41005969-41005991 AGGAAGAGAGGAAGGGAGGAAGG - Intronic
1081475193 11:43422792-43422814 AGGAGGTGAGGAAGTGAGGATGG + Intronic
1082131485 11:48495130-48495152 AAGAGGAGAAGAAGGAAGGAAGG - Intergenic
1082215366 11:49561376-49561398 AGGTGGAGAGGAAAAGAGGACGG + Intergenic
1083000128 11:59283772-59283794 AGGTGGGGAAGAAAAGAAGACGG + Intergenic
1083031103 11:59593173-59593195 AGGTGGAGGAAAAGGGAGGAAGG + Intronic
1083265018 11:61542588-61542610 AGGTGGAGGAGAGGAGAGAAAGG + Intronic
1083359275 11:62094589-62094611 AGGTGGAGGAGAAGGAGGGAGGG + Intergenic
1083360169 11:62101427-62101449 AGGTGGAGGAGAAGGAGGGAGGG - Intergenic
1083592467 11:63903777-63903799 AGGTCGGGAAGCAGCGAGGTGGG - Intronic
1083822681 11:65181864-65181886 AGGAGGAGAAGGAGAGAGGGAGG + Intronic
1084021776 11:66422055-66422077 AGGCAGAGAAGAAGTGAGGAAGG - Intronic
1084104268 11:66970802-66970824 AGGCAGAGAAGCAGTGAGGAGGG + Intergenic
1084208855 11:67611691-67611713 AGGTGGAAGAGGAGGGAGGAAGG + Intronic
1085365139 11:75934365-75934387 TGGTGGGGAGGAAGTGAGGATGG + Intronic
1085454551 11:76658361-76658383 GGGTGGAAAGGAAGGGAGGAGGG + Exonic
1085641285 11:78194673-78194695 AGGTGGAGGAGAAGGGCAGAAGG + Intronic
1085992249 11:81863330-81863352 AAGAGGAGAAGAAGGGAAGAAGG + Intergenic
1086391918 11:86374398-86374420 AGCTGGAGAAGTGGGGAGGAGGG - Intergenic
1086943561 11:92822648-92822670 AGGTGGAGAGGATGCGTGGGTGG - Intronic
1087237362 11:95734848-95734870 AGGAAGGGAAGAAGGGAGGAAGG + Intergenic
1088108308 11:106229964-106229986 AGGTGGGGGAGAATTGAGGAAGG - Intergenic
1088524224 11:110735241-110735263 AGGAGGAGAAGAAGGGGAGAAGG + Intergenic
1088533415 11:110835152-110835174 AGGTGGAAAAGAACAGATGAAGG - Intergenic
1089196267 11:116695617-116695639 AGGAGGAAAGGAAGGGAGGAGGG - Intergenic
1089464942 11:118678999-118679021 AGGAGGAGAGGAAGGGAGGGCGG + Intronic
1089514053 11:119020346-119020368 TGGTGGAGAAGGTGGGAGGAGGG + Intronic
1089583067 11:119493520-119493542 ATGAGGGGAAGATGCGAGGAGGG + Intergenic
1089875720 11:121719934-121719956 TGGAGGAGGAGAAGCCAGGAAGG - Intergenic
1090062615 11:123477235-123477257 AGGGGGAGAAGGGGAGAGGATGG - Intergenic
1090333750 11:125949739-125949761 AGGTGGGGCAGAAGAGAGGTAGG - Intergenic
1090403006 11:126460935-126460957 GGCTGGGGAAGAAGCGAGGGTGG + Intronic
1090569526 11:128031158-128031180 AGGAGGAGGAGAAGGAAGGAAGG + Intergenic
1090839940 11:130478742-130478764 AGAGGGAGATGAAGAGAGGAGGG + Intergenic
1091060051 11:132452628-132452650 AGGAGGTGAAGAAGGAAGGAAGG - Intronic
1091171830 11:133526469-133526491 GGGTGGTGAAGAAGAGAGGAGGG + Intronic
1091218813 11:133918946-133918968 AGGGGGAGGAGGAGCGGGGACGG + Intronic
1091399529 12:173771-173793 AGGTGGAGGAGATGGGTGGAAGG - Intronic
1091568445 12:1663864-1663886 AGGGGGAAAGGAAGGGAGGAAGG + Intergenic
1091942543 12:4501261-4501283 AGGTGGACAAGTAGGGAGTAAGG - Intronic
1092041900 12:5392788-5392810 ATGGGGAGAAGAGGAGAGGAAGG - Intergenic
1092258903 12:6941970-6941992 AGGTGGGGAGGTGGCGAGGATGG + Exonic
1092498229 12:9019658-9019680 AGGTGGGGAAGATGGGAGTACGG - Intergenic
1092850277 12:12619851-12619873 AGGTAGAAAAGAAGTGTGGAGGG - Intronic
1092937915 12:13380848-13380870 AGGTGGAGATGGAGGGAGGATGG - Intronic
1092943955 12:13436051-13436073 TGGAGGAGAAGAAGTGAGGAAGG - Intergenic
1093073975 12:14737983-14738005 ATGTGGAGCAGAACTGAGGAGGG - Intergenic
1093417990 12:18942438-18942460 AGGTGGAGAAGAAGGAAGGGTGG + Intergenic
1093659431 12:21736941-21736963 AGGAAGAGAGGAAGGGAGGAAGG - Intronic
1094135933 12:27126201-27126223 AGGGAGAGAGGAAGGGAGGATGG - Intergenic
1094185478 12:27637948-27637970 AGGGAGAGAGGAAGGGAGGAAGG - Intronic
1094207712 12:27858275-27858297 AGGTGGAGACAAAGGGAGGCTGG - Intergenic
1094628248 12:32146838-32146860 AGGAGGAGGAGAAGGAAGGAAGG - Intronic
1095781569 12:46065892-46065914 AGTGGGAAAAGAAGAGAGGAAGG - Intergenic
1096069161 12:48765264-48765286 GGGTGGAGAGGTAGCGACGAAGG - Intergenic
1096977173 12:55706199-55706221 AGATGGAGAAGGAGGGAGGAAGG + Intronic
1097245610 12:57606008-57606030 AGCTGGGGAAGAAAGGAGGAAGG + Intronic
1097770451 12:63578325-63578347 GGGTGGAGGGGAAGTGAGGATGG + Intronic
1097926493 12:65134070-65134092 AGGAAGAGAGGAAGGGAGGAAGG + Intergenic
1098116548 12:67184740-67184762 AGGAGGAGGAGGAGGGAGGAGGG + Intergenic
1098588523 12:72184386-72184408 GGCTGGGGAAGAAGCGGGGAGGG - Intronic
1098907988 12:76181040-76181062 AGGAAGAGAAGAAGGAAGGAAGG - Intergenic
1098939281 12:76516340-76516362 TTGTGGAGAAGAGGCTAGGAAGG - Intronic
1099811502 12:87588071-87588093 AGGAGGAGAAAAAGGAAGGAGGG + Intergenic
1100643324 12:96503392-96503414 AGGGAGAGAGGAAGGGAGGAAGG - Intronic
1100862226 12:98818176-98818198 AGGAAGAGAGGAAGAGAGGAAGG - Intronic
1101036124 12:100708452-100708474 AGGAAGAGAGGAAGGGAGGAAGG - Intergenic
1101241015 12:102840175-102840197 AGGTGGAGTGGAATCTAGGAAGG + Intronic
1101285368 12:103306498-103306520 AGGAGAAGAAGAAGAGGGGAGGG + Intronic
1101751489 12:107586079-107586101 GGGTAGAGAGGAAGTGAGGAGGG + Intronic
1102052976 12:109876595-109876617 AGGAAGGGAAGAAGGGAGGAAGG + Intronic
1102411648 12:112725370-112725392 TGGTGGAGAAGAGGGGAAGAGGG + Intronic
1102448915 12:113026013-113026035 AGGTAGGGAAGAAGGAAGGAAGG - Intergenic
1102652454 12:114451835-114451857 AGGGAGAAAAGAAGGGAGGAAGG - Intergenic
1102971575 12:117172014-117172036 AGTGGGAGAGGAAGAGAGGAAGG - Intronic
1103183528 12:118936090-118936112 AGGTGGGGAAGGAGCGAGGAGGG - Intergenic
1103245756 12:119455828-119455850 AGGAGAAGAAGAAGGAAGGAAGG + Intronic
1103265471 12:119626510-119626532 AGGAGGAGGAGAAGGGAGAAGGG + Intronic
1103562333 12:121799338-121799360 AGGTGGAGAAGCGTCAAGGAAGG + Intronic
1103586647 12:121961246-121961268 AGGGGGAGAAGAAAGGAGGGAGG - Intronic
1103769114 12:123306611-123306633 AGGTGGACAAGGTGAGAGGATGG + Intronic
1103870465 12:124087521-124087543 AGGTGGAGAAGGAGCCCGAAGGG - Intronic
1103937874 12:124486079-124486101 AGCTGGAGAAGAAGGAAGAATGG + Intronic
1104172486 12:126295779-126295801 AGGGAGAGAAGAAGGAAGGAAGG + Intergenic
1104463204 12:128971413-128971435 AGGAGGAGAGGAAGGGAGGAGGG - Intronic
1104781276 12:131422094-131422116 AGGTGGAGGAGGAGGGAGGAGGG - Intergenic
1104896949 12:132169200-132169222 AGGGGGAGAAGCAGGGAGGGCGG + Intergenic
1104896975 12:132169268-132169290 AGGGGGAGAAGCAGGGAGGGCGG + Intergenic
1105602783 13:21901974-21901996 AGCTTGAGAAGGAGCCAGGAAGG - Intergenic
1105782009 13:23714124-23714146 AGATGGAGAGGAAAAGAGGATGG - Intergenic
1106123107 13:26878239-26878261 AAGTTGAGAGGAAGCGAGGGTGG + Intergenic
1106197823 13:27509297-27509319 AGATGGAGAAGAAAACAGGATGG - Intergenic
1106227659 13:27797105-27797127 AGCTGGAGAAGAGGCGAGTGCGG - Intergenic
1106389964 13:29325511-29325533 AGGAGGAGGAGGAGGGAGGAAGG + Intronic
1106594329 13:31123732-31123754 AGGAAGAAAAGAAGGGAGGAGGG - Intergenic
1107077978 13:36344433-36344455 AGATGGAGATGTAGCAAGGAAGG - Intronic
1107342016 13:39417657-39417679 AGGTTAAAAAGAAGCGGGGAGGG - Intronic
1107837222 13:44421790-44421812 AGGGGAAGAAGAAGAGAGCAGGG - Intergenic
1107890062 13:44906261-44906283 AGGAGGAGGAGGAGGGAGGAGGG + Intergenic
1107897123 13:44976316-44976338 AGGAGGAGAAGAAAGGAGGAAGG + Intronic
1108118483 13:47157669-47157691 AGGGGGAGATGAAGAGAGGTTGG - Intergenic
1108478509 13:50843681-50843703 AGGTGGAGCAGCAGCGAGGGAGG + Exonic
1108889682 13:55239656-55239678 AAGTGGAGAAAAAGAGAGGGAGG + Intergenic
1109459886 13:62643028-62643050 AGGTGAAGAATAAGTCAGGATGG - Intergenic
1109862145 13:68213988-68214010 AAGTGGGGAGGAAGGGAGGAGGG - Intergenic
1109997615 13:70149929-70149951 AGGCAGAGAGGAAGTGAGGAAGG + Intergenic
1110119853 13:71866851-71866873 GGGGGGAGAAGGAGCGAGGGGGG + Intronic
1110398578 13:75063000-75063022 AGGGAGGGAAGAAGAGAGGAAGG + Intergenic
1110713074 13:78671279-78671301 AGGGAGAGAAGAAGAAAGGAGGG + Intergenic
1110741296 13:79000342-79000364 GGGTGGAGAAGATGCCAGAAAGG + Intergenic
1110816476 13:79865928-79865950 AGGGGAAGAGGAAGAGAGGAAGG + Intergenic
1110843975 13:80173145-80173167 AGGGAGGGAAGAAGGGAGGAAGG + Intergenic
1111086368 13:83380535-83380557 AGGGGGAGGAGAAGGAAGGAAGG - Intergenic
1112311085 13:98318047-98318069 AGGAGGAGGAGAAGGAAGGAAGG - Intronic
1112404595 13:99107842-99107864 AGGAAGCGAGGAAGCGAGGAAGG + Intergenic
1112855020 13:103757888-103757910 AGGTGGAGGAGGAGGCAGGAGGG - Intergenic
1112924503 13:104657356-104657378 AGGGAGAGAAGAAGGGAAGAGGG - Intergenic
1113282123 13:108799864-108799886 AGAGGAAGAAGAAGGGAGGAGGG + Intronic
1113303874 13:109054961-109054983 AGGAGGAAAAGGAGGGAGGAAGG - Intronic
1113418740 13:110153278-110153300 AGGCGGAGCAGAGGCAAGGACGG + Intronic
1113602842 13:111582903-111582925 AGATGCAGAAGAACAGAGGAAGG - Intergenic
1113975513 13:114225264-114225286 AGGGAGAGAAGAAGGGAGAAGGG + Intergenic
1115111415 14:29827936-29827958 AGGTGGAAAAGAAATGAGGGAGG - Intronic
1115888512 14:38001208-38001230 AGGATGAGAAGAAGGGAGGAAGG - Intronic
1115975476 14:38992148-38992170 AGGTGGAGAGGAAGAAGGGAGGG + Intergenic
1116010623 14:39347411-39347433 AGGAGGAAAAGAAGGAAGGAGGG + Intronic
1116803003 14:49463275-49463297 AGGTGGGGGAGAAGTGGGGATGG - Intergenic
1117187089 14:53251013-53251035 AGGAGGAGAAGGAGGGAGGGAGG - Intergenic
1117205024 14:53433347-53433369 AGGTTGAGAAGAATGGAGGTGGG - Intergenic
1117754086 14:58956175-58956197 AGCTGGAGAACAAGGGAAGATGG + Intergenic
1117795177 14:59386172-59386194 AGGACGATAAGAAGAGAGGAAGG - Intergenic
1118186375 14:63542550-63542572 AGGTGGAGAAAAAGGGGGGAGGG + Intronic
1118320239 14:64748610-64748632 GGGGGGAGAAGCAGAGAGGAGGG + Exonic
1118341793 14:64900088-64900110 ATGTGGAGAAGTTGAGAGGAGGG - Intergenic
1118369762 14:65127805-65127827 AGGAAGCGAGGAAGCGAGGAAGG - Intergenic
1119180157 14:72600085-72600107 AGGAGGAGAAGAAGGGAGGGGGG - Intergenic
1119201629 14:72757060-72757082 AGGGGGAGAGGAAGGAAGGAAGG + Intronic
1119551342 14:75516165-75516187 AGGAGGGGAAGGAGGGAGGAAGG - Intergenic
1119591241 14:75889854-75889876 AGGAAGGGAAGAAGCGAGGGAGG + Intronic
1119684837 14:76623352-76623374 ATGTGGAGAAGAAGGGAGGAGGG - Intergenic
1119728758 14:76938032-76938054 AGGTGGAAAGTAAGTGAGGAAGG + Intergenic
1119895565 14:78216802-78216824 AAGCCGAGAAGAGGCGAGGAAGG - Intergenic
1120265134 14:82239062-82239084 AGGGGGAGAAGCAGGAAGGAAGG + Intergenic
1120438680 14:84509377-84509399 AGGAGGGGAGGAAGGGAGGAAGG + Intergenic
1121048448 14:90804569-90804591 CGGTGGAGCAGAGGCTAGGAAGG + Intronic
1121075632 14:91065949-91065971 AGATGGAGAAGTAGAGAGGGTGG + Intronic
1121231041 14:92358632-92358654 AGGTGGTGAAGAAAAGAAGATGG - Intronic
1121489668 14:94348868-94348890 ATGTGGAGCAGAAGCAGGGAGGG - Intergenic
1122030530 14:98908365-98908387 AGGTGGGGAAGGAGTGAGGGAGG - Intergenic
1122413592 14:101538169-101538191 AGGTGGGGAGGAAGACAGGAGGG + Intergenic
1122448111 14:101782806-101782828 AGGGGGAGAACAAGAGAGAAAGG - Intronic
1122631427 14:103109323-103109345 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631441 14:103109359-103109381 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631455 14:103109395-103109417 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631469 14:103109431-103109453 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631483 14:103109467-103109489 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631497 14:103109503-103109525 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631525 14:103109576-103109598 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631539 14:103109612-103109634 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631553 14:103109648-103109670 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122950001 14:105038447-105038469 AGGTGGGGGAGAAGCTGGGAAGG - Intergenic
1123199590 14:106650066-106650088 AGAGAGAGAAGAAGGGAGGACGG + Intergenic
1123539304 15:21272202-21272224 AGGGAGAGAGGGAGCGAGGAAGG - Intergenic
1124133506 15:27011356-27011378 AGGAGGAAGAGAAGCCAGGAAGG - Intronic
1124372303 15:29110708-29110730 AGGGGGAGAAGAGATGAGGAAGG + Intronic
1124710784 15:32008340-32008362 AGGAGGAGGAGAAGGGAGGGAGG - Intergenic
1124957794 15:34370979-34371001 AGGAGGAGAAGAAGAAAAGACGG - Intergenic
1125898711 15:43325696-43325718 GGGGGGAAAAGAAGGGAGGAGGG - Exonic
1126117572 15:45222460-45222482 AGATGGAGAACAAGGGAGAAAGG + Intergenic
1126359286 15:47829128-47829150 ATGTGGAGAAGAGCAGAGGAAGG + Intergenic
1126388519 15:48119948-48119970 AGGAGGAGGAGAAGAAAGGAAGG + Intergenic
1126469653 15:48994778-48994800 AGCTGGAGTGGAAGTGAGGAGGG - Intronic
1126477481 15:49080431-49080453 AGGAAGAGAGGAAGGGAGGAAGG - Intergenic
1126652413 15:50938106-50938128 AGGTGGAGAACAAGTCAGGCTGG + Intronic
1126745995 15:51827150-51827172 AGGAGTGGAAGAAGTGAGGAAGG + Intergenic
1126929381 15:53631240-53631262 GGCTGGAGAAGGAGCGAGGGAGG - Intronic
1127044602 15:55012344-55012366 AGGTGGAGAAACATCGATGAGGG - Intergenic
1127149530 15:56059232-56059254 AGATCAAGAAGAAGCCAGGAAGG + Intergenic
1127642362 15:60928054-60928076 ACCTGGAGAAGATGGGAGGATGG - Intronic
1127920168 15:63488148-63488170 AGGTGGAAAGGGAGGGAGGAGGG - Intergenic
1128095794 15:64954346-64954368 AGAAGGAGAAGAAGAGAAGAAGG - Intronic
1128149884 15:65356033-65356055 AGGTGGAGAAGGCTCGGGGAGGG - Intronic
1128347830 15:66865785-66865807 AGGTGAAGGAGGAGAGAGGAAGG - Intergenic
1128681896 15:69658522-69658544 AAGAGGAGGAGAGGCGAGGAGGG - Intergenic
1128705031 15:69832326-69832348 AAGGGAAGAAGAAGCGGGGAAGG + Intergenic
1128792299 15:70442242-70442264 AGAAGTAGAAGCAGCGAGGAGGG + Intergenic
1129243428 15:74265383-74265405 AGGAGGAGAAGGATAGAGGAGGG - Intronic
1129620869 15:77144364-77144386 AGGTGGAGGAGTAGAGAGTAGGG - Intronic
1129683454 15:77671360-77671382 AGGAGGAGAAGAAAAGAGGTGGG + Intronic
1129933059 15:79428290-79428312 AGGGAGAGAAGAAGGAAGGAGGG - Intergenic
1130127411 15:81105349-81105371 AGGAGGAAAAGAAGGAAGGAGGG - Intronic
1130178184 15:81596815-81596837 AGGTGGGGAAGATGCCAGAAGGG + Intergenic
1130226042 15:82058985-82059007 AGGAGGAGAAGGAGGGAGGTAGG - Intergenic
1130721100 15:86386257-86386279 AGGAGGAGGAGGAGGGAGGAGGG - Intronic
1130953927 15:88613473-88613495 AGCTGGAGAACAGGAGAGGAGGG + Intergenic
1130967192 15:88706029-88706051 AGGGGGACAAGAAGGGAGGCAGG - Intergenic
1131063929 15:89421369-89421391 AGGTGGGCACGAAGCGAGAAAGG - Intergenic
1131139826 15:89968116-89968138 AGGAGGAGGAGGAGGGAGGAGGG + Intergenic
1131264061 15:90905430-90905452 AGATGGAGAAGAAGCTGGGCCGG - Exonic
1131284725 15:91047842-91047864 AGGAGGAGGAGTAGGGAGGACGG - Intergenic
1131401169 15:92126706-92126728 AGGGGGAGAAAAAGGGAGGGAGG + Intronic
1131852111 15:96554578-96554600 AGTAGGAGAAGGAGGGAGGAGGG - Intergenic
1131860778 15:96651131-96651153 TGGTGCAGAAGAAAGGAGGAAGG + Intergenic
1132070422 15:98771881-98771903 CAGTGGAGAAGAAGGAAGGAGGG - Intronic
1132075334 15:98815374-98815396 AGTTGTTGAAGAAGTGAGGAGGG + Intronic
1132149410 15:99448690-99448712 AGGTGGAGAAGCAGCAGTGAAGG + Intergenic
1132306570 15:100819180-100819202 AATTGGAGAGGAAGAGAGGAGGG + Intergenic
1132535044 16:474627-474649 AGTGGGAGAAGGAGGGAGGACGG - Intronic
1132997912 16:2832896-2832918 AAGTGGAGACAAAGGGAGGAGGG + Intronic
1133387068 16:5378370-5378392 GGGTGGAGTGGAAACGAGGATGG - Intergenic
1133482394 16:6183808-6183830 AGCTGGGGTAGAAGCTAGGAGGG + Intronic
1133520293 16:6549556-6549578 AGGAGGGGAGGAAGGGAGGAAGG + Intronic
1133760816 16:8797169-8797191 AGAAGGAGAAGGAGCGAGGCAGG + Intronic
1133820546 16:9232378-9232400 AGGTGGAGAAAAAGGAAGGGAGG - Intergenic
1133840592 16:9404884-9404906 AAGTGGAGGAGAAGAGAAGATGG + Intergenic
1133853070 16:9524284-9524306 AGGTGGGGAGGAAGGGAGGGAGG - Intergenic
1133937930 16:10284086-10284108 GGGTGGAGAAATGGCGAGGAGGG - Intergenic
1134121770 16:11588895-11588917 AGGAAGGGAGGAAGCGAGGAAGG - Intronic
1134196530 16:12163334-12163356 AGGTGGGGTAGCAGGGAGGAGGG + Intronic
1134318241 16:13139421-13139443 AGGAAGAGAAGAAGGAAGGAAGG - Intronic
1135162883 16:20113028-20113050 ACATGGAGAAGTAGCGAGGGAGG + Intergenic
1135197619 16:20407654-20407676 AGTTGGAGGAGAAGTGGGGATGG + Intergenic
1135229637 16:20693711-20693733 AAGTGGAGAAGCAGGCAGGAGGG - Intronic
1135398346 16:22148127-22148149 AGGTGGGGAAGAGGCAGGGAGGG - Intronic
1135407892 16:22211151-22211173 AGGTGGAGAAGAAGTGAGAGAGG - Intronic
1135806468 16:25547296-25547318 AGGAGGGGAAGTAGGGAGGAAGG - Intergenic
1135913146 16:26579210-26579232 AGGAGAAGAAGAAGGAAGGAAGG - Intergenic
1136065153 16:27753745-27753767 AGGAGGAAAAGAAGGAAGGAGGG - Intronic
1136249327 16:28993581-28993603 AGGTGGAGAAGATGGTGGGAGGG + Intergenic
1136285582 16:29238509-29238531 AGGGAGGGAAGAAGGGAGGAGGG + Intergenic
1136556568 16:31010681-31010703 AGGTGAGGAGGAAGCGAGGGCGG + Intergenic
1136557796 16:31018434-31018456 AGGTGATGAAGGAGGGAGGAGGG + Intergenic
1137934563 16:52622130-52622152 AGGTGGATGAGAAGGGAGGCAGG + Intergenic
1138091116 16:54175437-54175459 TGGGGGAGAAAAAGCGAGGGTGG - Intergenic
1138167400 16:54815892-54815914 AGGAAGAGAGGAAGGGAGGAAGG + Intergenic
1138329601 16:56203079-56203101 AGGTGCAGAAGAAGCAGTGATGG + Intronic
1138561198 16:57802013-57802035 GGGTGGGGAAGACGCCAGGAAGG + Intronic
1138609508 16:58111476-58111498 AGGTGGAGAAGTGGAGGGGAGGG - Intergenic
1139165757 16:64563339-64563361 AGGTGGAGGAGGAGGGAAGAAGG + Intergenic
1139210036 16:65068033-65068055 AGGGAGGGAAGAAGGGAGGAAGG + Intronic
1139401429 16:66684882-66684904 AGGTGGAGAGGAAGAGAGCAGGG - Intronic
1139424937 16:66873724-66873746 AGAAGGAGGAGAAGGGAGGAGGG - Intergenic
1139952535 16:70679199-70679221 AGGCCAAGGAGAAGCGAGGAAGG - Intronic
1141046979 16:80724074-80724096 AGGAGGAAAAGAGGAGAGGAAGG + Intronic
1141097784 16:81175152-81175174 AGGTTGAGACCAAGAGAGGAGGG - Intergenic
1141263675 16:82476238-82476260 AGGAGGAGAAGGAGGGAGGAGGG - Intergenic
1141287022 16:82681983-82682005 AGGTGAAGGAGAAACCAGGAGGG - Intronic
1141329053 16:83091237-83091259 AGATGGAGAAAAAGGGAGTAGGG - Intronic
1141372442 16:83500480-83500502 AGGGGGAGGAGGAGGGAGGAAGG - Intronic
1141393188 16:83681548-83681570 AAGGGGAGAAGAACGGAGGAGGG - Intronic
1141427161 16:83951947-83951969 AGGGGGGGAAGGAGGGAGGAAGG - Intronic
1141427202 16:83952055-83952077 AGGGGGGGAAGGAGGGAGGAAGG - Intronic
1141691436 16:85598970-85598992 AGGGGGAGTAGGAGAGAGGAGGG - Intergenic
1141775759 16:86121749-86121771 AGGAGGAGGAGGAGGGAGGAAGG - Intergenic
1142090915 16:88208661-88208683 AGGGAGGGAAGAAGGGAGGAGGG + Intergenic
1142137526 16:88458474-88458496 AGTTGGAGAAGAAAGGAGGAGGG + Intronic
1142179177 16:88658963-88658985 TGCTGGAGTAGAAGCGATGAAGG - Intronic
1142251472 16:88993847-88993869 GGGAGGGGAAGAAGGGAGGAGGG - Intergenic
1142308332 16:89298167-89298189 TGGTGAACAAGAAGCCAGGAAGG + Intronic
1142609600 17:1101461-1101483 AGGAGGAGAGGAAGAGAGGGAGG - Intronic
1143165579 17:4895767-4895789 AAGTGGAGAAGAAGCAGGGCTGG + Exonic
1143476035 17:7204516-7204538 AGGTGTAGGAGAAGCGGGAAGGG + Intronic
1143632374 17:8146565-8146587 AGGTGGAGAAGATGCCTGGCAGG + Intronic
1143716702 17:8776879-8776901 AGCTGGAGAGGGAGAGAGGATGG + Intergenic
1143734303 17:8899676-8899698 AAGTGGAGAAAGAGCTAGGATGG - Intronic
1143743104 17:8968118-8968140 AGGTGGAGGAGAAGCCAAGGAGG - Intergenic
1143869754 17:9949772-9949794 AGGAGGAGAGGAAGGGAGGAGGG - Intronic
1143963398 17:10738917-10738939 GGGAGGAGAGGAAGGGAGGAAGG - Intergenic
1143979393 17:10855013-10855035 AGGTTGAGAAGAATGGGGGATGG + Intergenic
1144063178 17:11601323-11601345 AGGAGGGGAAGAAGAGAGAAAGG + Intronic
1144365623 17:14541775-14541797 AGAGGGAGAAGGAGTGAGGAAGG - Intergenic
1144397189 17:14856125-14856147 AGGTGGTGAAGAAGCAGAGAAGG - Intergenic
1144571865 17:16405344-16405366 AGGTGGGGGAGAAGCTGGGAAGG + Intergenic
1145107026 17:20126264-20126286 AGGGAGAGAAGAAGAGAGGAAGG - Intronic
1145280832 17:21465818-21465840 AGGAAGAGAAGAAGCGGGGAAGG + Intergenic
1145397079 17:22504746-22504768 AGGAAGAGAAGAAGGGGGGAAGG - Intergenic
1145883007 17:28365317-28365339 CGGTGGGGAAGAAGGGAGGCTGG + Intronic
1146718111 17:35103332-35103354 AGGAGGAGAAGCAGAGAGGGAGG + Intronic
1147334551 17:39719542-39719564 TGGTGGATAGGAAGCGGGGAGGG - Intronic
1147588434 17:41666229-41666251 AGGGGGAGCAGGAGAGAGGAAGG - Intergenic
1148166993 17:45490622-45490644 AGGGGGTCAAGATGCGAGGAGGG - Intronic
1148187506 17:45655337-45655359 AGGTGGGGGAGATGTGAGGATGG + Intergenic
1148396686 17:47313670-47313692 AGGTGGTTAGGAAGTGAGGAAGG - Intronic
1148789275 17:50164324-50164346 AGGTGGAGAGAGAGAGAGGAAGG + Intronic
1149560474 17:57604728-57604750 AGAAGGATAAGAAGGGAGGAGGG + Intronic
1149729549 17:58931417-58931439 AGGGAGAGAAGGAGGGAGGAAGG + Intronic
1150002153 17:61447727-61447749 AGCTGGGAAAGAAGTGAGGAGGG + Intergenic
1150125593 17:62632611-62632633 AGGTGGGAAAGAAGAGGGGAGGG - Intronic
1150398170 17:64837026-64837048 AGGGGGTCAAGATGCGAGGAGGG - Intergenic
1150628619 17:66859879-66859901 AGGTGGAGAAGAAGGAAGAAGGG - Intronic
1150644250 17:66968403-66968425 AGGAGGAGAAAAAGGGAGAAGGG - Intronic
1150979744 17:70127618-70127640 AGGAGGAGGAGACGGGAGGATGG - Intronic
1151052646 17:70995887-70995909 AAGAGGAGAAGAAGAGAAGATGG - Intergenic
1151290839 17:73148705-73148727 AGGGGGAGAAGAAGAGAGGATGG - Intergenic
1151433142 17:74078462-74078484 AGGTGGAGAAGAAGGGAGGGTGG + Intergenic
1151454516 17:74218048-74218070 AGGTGGAGGGGAATGGAGGAGGG - Intronic
1151763330 17:76119756-76119778 AGGAGGAGGAGGGGCGAGGAAGG + Intronic
1151821325 17:76498422-76498444 AGGGGGAGAGGCAGCCAGGAGGG + Intronic
1151871635 17:76840756-76840778 AGGTAGAAAAGAAGAGAGGGAGG - Intergenic
1151896387 17:76983412-76983434 GGCTGGAGGAGAAGGGAGGAGGG - Intergenic
1152003232 17:77660428-77660450 AGGGAGAGAAGAAGGAAGGAGGG - Intergenic
1152124553 17:78438432-78438454 AGGAGGAGGAGGAGGGAGGAGGG + Intronic
1152410609 17:80120688-80120710 AGGAGGAGAGGAGGTGAGGAGGG - Intergenic
1152476175 17:80519743-80519765 AGGTAGAGAAGAAGGAAGGCAGG - Intergenic
1152506900 17:80755298-80755320 AGTTGGAGATGAAGGGAAGAGGG + Intronic
1153044266 18:841469-841491 AGGTGGGGGAGAAGCTGGGAAGG - Intergenic
1153107328 18:1542656-1542678 AGGAGGAGGAGAGGAGAGGAGGG - Intergenic
1153328569 18:3848288-3848310 AGGAGGAGCAGTAGGGAGGAGGG + Intronic
1153632801 18:7088222-7088244 CGGAGGAGACGAAGGGAGGAAGG - Intronic
1153979592 18:10297665-10297687 AGGGGGAGAAGCAGGAAGGAGGG - Intergenic
1154141204 18:11826239-11826261 AGGAGGAGGAGGAGCGGGGAGGG + Intronic
1154141216 18:11826271-11826293 AGGAGGAGGAGGAGCGGGGAGGG + Intronic
1154141238 18:11826335-11826357 AGGAGGAGGAGGAGCGGGGAGGG + Intronic
1155350032 18:24897335-24897357 AGGAGGAGGAGAAGGGGGGAAGG - Intergenic
1155400816 18:25437330-25437352 AAGTGGAATAGAAGCGTGGAGGG - Intergenic
1156071952 18:33222304-33222326 AGGGAGGGAAGAAGGGAGGAAGG - Intronic
1156447443 18:37248156-37248178 AGGTGGAGCAGAAACGGGGGAGG - Intronic
1156584135 18:38413296-38413318 TGGTGAGGAAGAAGAGAGGATGG - Intergenic
1156966900 18:43105467-43105489 AGGAAGAGAGGAAGGGAGGAAGG + Intronic
1157085192 18:44573384-44573406 GGGAGGGGAAGAAGGGAGGAAGG + Intergenic
1157102445 18:44743044-44743066 AGGTGGAGAATAAGAGAAGGAGG - Intronic
1157220406 18:45825253-45825275 AGGGAGAGGAGAAGGGAGGATGG + Intergenic
1157297359 18:46456063-46456085 AGATGGAGAAGATGTGAGGTAGG + Exonic
1157406267 18:47424735-47424757 AGAAGGAGAAGAAGGGAGAAGGG - Intergenic
1157814785 18:50722665-50722687 AGGTGCAGAACAAGGGAGGCAGG + Intronic
1157976967 18:52338973-52338995 AGGTGGGGAAGAATCTAGTAAGG + Intergenic
1158041534 18:53100619-53100641 AGGTGGGGAAGAAAGGAGAAAGG + Intronic
1158313930 18:56189710-56189732 AGGTGGAAAAGAAGCGAGAAAGG + Intergenic
1158528198 18:58234311-58234333 AGGGAGAGAAGGAGGGAGGAAGG - Intronic
1158832783 18:61298378-61298400 AAGAGGAGAAGAAGCAAGGAGGG + Intergenic
1158851089 18:61496184-61496206 GGGGGGAGAGGAAGGGAGGAGGG - Intronic
1158851129 18:61496295-61496317 AGGGGGAGAGAAAGGGAGGAGGG - Intronic
1159006921 18:63021547-63021569 AGGTGGAAAAGAAGGGATGGAGG - Intergenic
1159343575 18:67169210-67169232 AGGGAGAGAAGAAGGAAGGAAGG + Intergenic
1159507391 18:69354785-69354807 AGGAGGAGAAGATGAGAGTAAGG - Intergenic
1159962137 18:74563676-74563698 AGGCAGAGAAGAAGGGAGGGAGG - Intronic
1160087297 18:75788494-75788516 AGGAAGGGAAGAAGGGAGGAAGG - Intergenic
1160685100 19:430938-430960 AGGTGGAGAGAAGGCGGGGAAGG - Intronic
1161260109 19:3332936-3332958 AGGGAGGGAAGAAGGGAGGAAGG - Intergenic
1161403991 19:4081763-4081785 AGGGGGAGTAGGAGGGAGGAAGG - Intergenic
1161537976 19:4831589-4831611 AGGTGGGGAAGGGGCGAGGACGG - Intronic
1161821703 19:6534022-6534044 AGGTGGACAGGGAGCTAGGAGGG - Intronic
1161874429 19:6896787-6896809 GGGTGGGGAAGTAGCAAGGAAGG - Intronic
1162105378 19:8366847-8366869 AGGAGGAGAACAAGAGAGGAAGG - Intronic
1162338509 19:10076722-10076744 AGGAGGAGAGGAAGGAAGGAAGG + Intergenic
1162496886 19:11028388-11028410 AGGTGGAAAGGAAGCCAAGATGG - Intronic
1162977344 19:14214570-14214592 AGGAAGATAAGAAGGGAGGAAGG + Intergenic
1163093236 19:15035910-15035932 AGGAAGAGAGGAAGAGAGGAGGG + Intergenic
1163350326 19:16772856-16772878 AGGGAGAGAAGAAGGGAGGGAGG + Intronic
1163465820 19:17468040-17468062 AGGAGGAGAGGAGGGGAGGAGGG + Intergenic
1163618339 19:18342623-18342645 AGGTGGAGGTGAAGACAGGAAGG + Intronic
1164207780 19:23072192-23072214 AGGAGGAAAAAAAGGGAGGAAGG + Intergenic
1164249730 19:23466285-23466307 AGGAGGAGATGAGGAGAGGATGG - Intergenic
1164441134 19:28281771-28281793 GGTTGGAGAAGAAGAGAAGAGGG - Intergenic
1164469875 19:28521119-28521141 TGTTGGAGGAGAAGAGAGGAAGG + Intergenic
1164521276 19:28982126-28982148 AGATGGGGAGGAAGGGAGGAAGG + Intergenic
1164794377 19:31014488-31014510 AGGGAGAAAAGAAGGGAGGAAGG + Intergenic
1164794430 19:31014709-31014731 AGGGAGAGAAGAAGGGAGGGAGG + Intergenic
1164886314 19:31781709-31781731 AGGTGGAGGAGAAGCCATGGAGG + Intergenic
1164916756 19:32058234-32058256 AGGAGGAGATGAAGGAAGGAAGG - Intergenic
1165386125 19:35511649-35511671 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1165405244 19:35626663-35626685 AGGGAGGGAAGAAGGGAGGAAGG + Intergenic
1165538731 19:36472613-36472635 AGGAGGATGAGAAGCTAGGAAGG + Intronic
1165744730 19:38224073-38224095 AGGCGGAGAGGAAGCGCGGGCGG - Intronic
1166329494 19:42069926-42069948 AGGTGGAGAGATAGGGAGGAGGG + Intronic
1166723395 19:45010597-45010619 AGGAGGAGAAGCAGCCAGCATGG + Intronic
1166789511 19:45390258-45390280 AGGTGGGGGAGAAGCTGGGAAGG - Intronic
1167189959 19:47979162-47979184 AGGAGGAGGAGGAGGGAGGAAGG - Intronic
1167473060 19:49686034-49686056 AGGAGGGGATGAAGCGAGGTGGG + Intronic
1167627755 19:50603936-50603958 AGGAAGAGAAGGAGCGGGGAAGG - Intergenic
1167779930 19:51592695-51592717 AGGAGAAGGAGAAGGGAGGAAGG + Intergenic
1167799230 19:51729581-51729603 AGGAGGAGGAGAATGGAGGAGGG + Intergenic
1168076609 19:53983727-53983749 AGGATGAGAAGAAGCCAGCAGGG + Exonic
1168147963 19:54430157-54430179 AGCTGGAGCAGAAGGGATGAGGG - Intronic
1168321758 19:55514618-55514640 AGAGAGAGAAGAAGGGAGGAAGG + Intronic
1168594430 19:57664190-57664212 AGGACGAGAGGAAGGGAGGAAGG + Intergenic
925013575 2:504441-504463 AGGAAGGGAAGAAGGGAGGAGGG - Intergenic
925079362 2:1051141-1051163 AGGGGGAGAGGGAGGGAGGAAGG - Intronic
925229457 2:2220042-2220064 GAGTGGAGAAGAGGGGAGGATGG + Intronic
925313238 2:2902780-2902802 AGGGGGACAGGAAGCCAGGAAGG - Intergenic
925372940 2:3360932-3360954 AAGGGGAGGAGAAGGGAGGAGGG + Intronic
925436900 2:3846250-3846272 AGGAGGAGAAGAAGGGAGTGGGG - Intronic
925493993 2:4425900-4425922 AGGAAGAGAGGAAGGGAGGAAGG + Intergenic
925496237 2:4452572-4452594 AGGAGGAGAGGAAGGGAGAAGGG - Intergenic
925548683 2:5044959-5044981 TGGAGGAAAAGAAGAGAGGAAGG + Intergenic
925594332 2:5540038-5540060 AGGTGGAGGGGAGGCGGGGAGGG + Intergenic
925719502 2:6813602-6813624 AGGGAGAGAAGAAGAGAGGGAGG + Intergenic
925719517 2:6813648-6813670 AGGAAGGGAAGAAGGGAGGAAGG + Intergenic
925981503 2:9180954-9180976 AGGTGAAGAAGCAGAGATGATGG - Intergenic
926244644 2:11113720-11113742 AGGTGGGGAGGAAGGAAGGAGGG - Intergenic
926317808 2:11724356-11724378 AGCTGGAGAGGGAGAGAGGATGG + Intronic
926399985 2:12487330-12487352 AGGAAGAGAGGAAGGGAGGAAGG + Intergenic
926442453 2:12904069-12904091 AGATGGAGAAGAAGAGGAGAAGG - Intergenic
926760924 2:16278410-16278432 AAGTTGAGGAGAAGGGAGGATGG - Intergenic
926776899 2:16432013-16432035 AGGTGAAGGAGAGGAGAGGAAGG + Intergenic
927911387 2:26902169-26902191 AGGGGGAGAGGGAGTGAGGAGGG + Intronic
928070998 2:28216637-28216659 AGGTAGAAAATAAGCTAGGAGGG - Intronic
928165442 2:28968403-28968425 AGGGAGAGAGGGAGCGAGGAGGG - Intronic
928305574 2:30167708-30167730 GGGTGGAGAAAATGTGAGGACGG + Intergenic
928360278 2:30657030-30657052 AGGAAGAGGAGAAGGGAGGAAGG - Intergenic
928510106 2:31994967-31994989 AGGGAGAGAGGAAGGGAGGAAGG + Intronic
928549441 2:32357022-32357044 AGGGGGAGAAGCAGGGAGGGAGG - Exonic
929423442 2:41818939-41818961 AGGAGGAGAGGAGGGGAGGAGGG + Intergenic
929610124 2:43264777-43264799 AGCTGGAGAAGAACACAGGAAGG + Intronic
930110633 2:47675804-47675826 AGATGGGGAAGAAGGAAGGAGGG + Intergenic
930287922 2:49456984-49457006 AGGTGGAGAAGAGGTGGGAAGGG - Intergenic
930709962 2:54541416-54541438 GGATGGAGAAGAGGCGAGGCTGG + Intronic
930731654 2:54733920-54733942 AGGTGGAGTAGAAGAGAAGGAGG + Intronic
931367185 2:61629140-61629162 GGGTGGAGAGAAAGTGAGGAGGG - Intergenic
931732332 2:65164359-65164381 AAGTGGAGAAGAAAAGAGGAGGG + Intergenic
932036596 2:68252399-68252421 AGGCAGAGAAGAAGAAAGGAGGG + Exonic
932216977 2:69972770-69972792 AGGAGGTGGAGAAGTGAGGAAGG - Intergenic
932334470 2:70922277-70922299 AAGTGGAGAGGAAGGGAGGAGGG + Intronic
932597327 2:73102103-73102125 GGGTGGGAAAGAGGCGAGGAGGG + Intronic
932643240 2:73472972-73472994 AGGTAGACAAAAAGCCAGGAAGG + Intronic
932731447 2:74224819-74224841 AGGTGGGGAAGATGTGAGGCCGG - Exonic
932863544 2:75318570-75318592 AGATGGAGAAGAAGCAACAAAGG + Intergenic
933027308 2:77276311-77276333 AGGAAGAGAAGAAGGAAGGAAGG + Intronic
933242655 2:79940475-79940497 AGGGATAGAAGAAGTGAGGATGG - Intronic
934947888 2:98555134-98555156 AGGTGGGGAGGAGGAGAGGAAGG - Intronic
935045141 2:99475302-99475324 AGGTGGAGGAGAACAAAGGAAGG + Intronic
935051491 2:99528753-99528775 AGGGGAAGAAGAAGGGAGGGAGG - Intergenic
935195509 2:100812638-100812660 ACGGGGAGAAGAATTGAGGAAGG + Intergenic
935218049 2:100989956-100989978 AGTTGGAGAAACAGCCAGGAGGG + Intronic
935320418 2:101882620-101882642 AAGTTGAGAAGAAGCAGGGATGG + Exonic
935358466 2:102226756-102226778 AGATGGAGGAGAAGGGAGGAAGG + Intronic
935422762 2:102886996-102887018 AGGCAGAGAAGAAGGGAGGGAGG - Intergenic
935788016 2:106566690-106566712 AAGGGGAGAGGAAGGGAGGAAGG - Intergenic
935863058 2:107354871-107354893 AAGAGGGGAAGAAGGGAGGAGGG + Intergenic
935891964 2:107688541-107688563 TGATGGAGAAGAAGCGTGCAGGG + Intergenic
936228468 2:110679328-110679350 TGGTGGAGAAGAAGCTGGGAGGG - Intergenic
936241005 2:110788828-110788850 TGGTGGAGGAGATGCCAGGAGGG + Intronic
936379406 2:111970744-111970766 AGGAGGAGGAGAAGGGAGGAGGG - Intronic
936998118 2:118436152-118436174 AGATGGTGAAGAAACCAGGAGGG + Intergenic
937005556 2:118509622-118509644 AAGTAGAGAAGAAGGGATGAAGG + Intergenic
937479210 2:122241580-122241602 AGGGTGAGAAGAAGGAAGGAGGG + Intergenic
937573362 2:123391008-123391030 AGGAGGAGAAGAAGAGGGGGAGG - Intergenic
937579062 2:123461447-123461469 AGGAGGAGAGGAAGGAAGGAAGG - Intergenic
937596117 2:123675784-123675806 AGGTTCAGAAGAAAAGAGGAAGG - Intergenic
938379890 2:130830638-130830660 AGATGGAGTAGAAGCTAGGGTGG - Intergenic
939096661 2:137840139-137840161 AGATGGAGAGGCAGCGAGAAGGG - Intergenic
939581179 2:143947855-143947877 AGGAGGTGAAGAAGGAAGGAAGG + Intronic
939623229 2:144446325-144446347 AGGGAGAAAAGAAGGGAGGAAGG - Intronic
940352934 2:152708789-152708811 AGGTGGAGGAGAGCTGAGGAAGG - Intronic
941132440 2:161670266-161670288 AGGAAGAGAAGAAAAGAGGAAGG - Intronic
941465191 2:165817246-165817268 AGGAGGAGAAGAAGGAAGGAAGG + Intergenic
942143490 2:173001739-173001761 AGGGGGAGCAGGAGCGAGGTGGG + Intronic
942731742 2:179067590-179067612 AGGAGGAGAGCAAGGGAGGAGGG - Intergenic
942764453 2:179437761-179437783 AAGTGGGGAAGAAGGGAGGGGGG + Intergenic
943280641 2:185928450-185928472 AGGAAGAGAAGAAGGGAGGAAGG + Intergenic
943395144 2:187324366-187324388 AGGTCCAGAAGCAGAGAGGATGG + Intergenic
944525220 2:200612014-200612036 AGGGGGAGAAAGAGCGAGAATGG - Intronic
944677904 2:202049422-202049444 AGGTGAAGGGGAAGGGAGGAGGG + Intergenic
945370245 2:209007183-209007205 AGGTGTAGAGGAAATGAGGAAGG - Intergenic
945680018 2:212902821-212902843 AGGAGGAGGAGAAGGAAGGAAGG - Intergenic
945869712 2:215213953-215213975 AGGAGGAGAGGAGGAGAGGAGGG + Intergenic
946449706 2:219769307-219769329 AGGGGGAGGAGAAGGGAGGGAGG - Intergenic
946450170 2:219772927-219772949 AGGAGGGGAAGAAAGGAGGAAGG + Intergenic
947094449 2:226550250-226550272 AGGTGGAGAAGACAGGGGGAGGG + Intergenic
947119370 2:226799654-226799676 AGGAGGAGGAGGAGGGAGGAGGG - Exonic
947240014 2:227984375-227984397 AGGTAGACAAGAAGCTAAGAAGG - Intronic
947264465 2:228261782-228261804 GGGTGCAGAAGAGGCTAGGAAGG + Intergenic
947475815 2:230446847-230446869 AAGTGAAGAAGAAGAGAGGGAGG + Exonic
947752617 2:232540699-232540721 TGCTGGAGAACAAGTGAGGAGGG + Exonic
947836770 2:233181419-233181441 AGGATGAGAAGAGACGAGGATGG - Intronic
948006853 2:234616805-234616827 AGTAGCAGCAGAAGCGAGGAGGG + Intergenic
948250227 2:236521882-236521904 AGGTGGGGAGGAAGGAAGGAAGG + Intergenic
948273286 2:236689880-236689902 AGGGGGAGAGGAAGGGAGGGAGG - Intergenic
948297524 2:236873548-236873570 AGGAAGAGAGGAAGGGAGGAAGG - Intergenic
948748230 2:240110863-240110885 AGGAGGAGAAGAGAGGAGGAGGG - Intergenic
1169226138 20:3858185-3858207 TGGGGGAGAAGAAATGAGGAAGG - Intronic
1169264343 20:4158484-4158506 AGGTGGAGAAGAAGGGAATCTGG - Intronic
1169425632 20:5495149-5495171 AGGAGGAGCAGCAGGGAGGAGGG + Intergenic
1169484261 20:6013432-6013454 AGATGGGGAAGAAGGGAGGCAGG + Intronic
1169585982 20:7086044-7086066 AGGAGGAAAAGAAGGAAGGAGGG - Intergenic
1170142513 20:13139090-13139112 AGGAGGAGAAGGAGGGAGGATGG - Intronic
1170385701 20:15814085-15814107 AGGAAGAGAAGAAGAGAGGAAGG + Intronic
1171084843 20:22228273-22228295 AGGTAAAGAAGAAGAGGGGAAGG + Intergenic
1171206040 20:23282235-23282257 AGGAAGGGAAGAAGGGAGGAAGG + Intergenic
1171386415 20:24772075-24772097 AGGGGGAGGTGAAGCAAGGAGGG + Intergenic
1171941145 20:31331014-31331036 AGGGGGAGAAGGAGAGAAGAAGG + Intergenic
1172043019 20:32059342-32059364 AGGAGGAGGAGAAGGGGGGAAGG - Intronic
1172206194 20:33164495-33164517 AGGAAGAGAAGAAGGGAGGGAGG - Intronic
1172336224 20:34118252-34118274 AGGAGAAGAATAAGCCAGGATGG + Intergenic
1172775765 20:37405880-37405902 TGGTGGGGAAGGAGGGAGGAGGG - Exonic
1173141526 20:40489075-40489097 ATGTGAAGAAGAGGAGAGGAAGG + Intergenic
1173438874 20:43057390-43057412 AGGAGGAAAAGAAGGAAGGAGGG + Intronic
1173561737 20:44010965-44010987 AGCCGGAGGAGAAGCGAGGCTGG - Intronic
1173581453 20:44149588-44149610 AGGTGGGGAAGAAGAGGGCAGGG - Intronic
1173596583 20:44262456-44262478 AGGGGGAGAAGCAGTGAGGCAGG + Intronic
1173942266 20:46921451-46921473 AGGTGCAGTAGAAACGAGAAAGG - Intronic
1173958374 20:47052338-47052360 AGGAGGAGGAGAAGCCAGCATGG + Intronic
1174209153 20:48863442-48863464 TTGTGGAGAAGGAGCGGGGAGGG - Intergenic
1174655355 20:52167482-52167504 AGGGAGAGAAGAAGGGAGGGAGG - Intronic
1174663025 20:52231576-52231598 AGGAGGAGGAGAAGGGAGGCAGG - Intergenic
1174941468 20:54933717-54933739 AGGAGGAGAAGAAGGAAGAAAGG + Intergenic
1175496850 20:59420508-59420530 AGGAAGAGAAGAAGGAAGGAAGG - Intergenic
1175606475 20:60315779-60315801 AGGTGGAGAGGGAGTGGGGAGGG - Intergenic
1175934529 20:62508996-62509018 GGGTGGAGGAGTAGAGAGGATGG - Intergenic
1176047389 20:63099948-63099970 AGGGAGAGAAGCAGCAAGGAGGG + Intergenic
1176105790 20:63385554-63385576 AGCTGCAGAAGAAAAGAGGAGGG + Intergenic
1176520086 21:7817905-7817927 AAGTCGGGAAGAAGCCAGGAAGG - Exonic
1177572670 21:22907495-22907517 AAGTGGTCAAGAAGAGAGGAAGG + Intergenic
1177786377 21:25675626-25675648 AGGAGGGAAAGAAGGGAGGAAGG + Intronic
1177896886 21:26863724-26863746 AGGAAGGAAAGAAGCGAGGAGGG - Intergenic
1178072463 21:28983821-28983843 AGATGAAGTAGAAGTGAGGAGGG - Intronic
1178142351 21:29698752-29698774 AGGTGGAGAAGAGGCTGGGGAGG - Intronic
1178576084 21:33792915-33792937 AAATGGAGAAGAAGGGAAGAAGG - Intronic
1178599665 21:33984866-33984888 ACGTGGAGAAGAACCTAGGAAGG + Intergenic
1178654113 21:34447917-34447939 AAGTCGGGAAGAAGCCAGGAAGG - Intergenic
1178862600 21:36301751-36301773 AGGTGGAGGAGAACAAAGGAAGG + Intergenic
1179109935 21:38437693-38437715 AGGAAAAGAGGAAGCGAGGATGG - Intronic
1179169325 21:38960801-38960823 AGGTGGAAATGGAGCGAGAAGGG - Intergenic
1179218850 21:39389087-39389109 AGGAAGGGAAGAAGGGAGGAAGG - Intronic
1179236095 21:39547760-39547782 AGGTGAAGGGGAAGCGAGCACGG + Intergenic
1179273485 21:39869554-39869576 AGGGGGAGAAGAGGGCAGGAGGG - Intronic
1179442447 21:41404569-41404591 AGGTGGGGAAGAAAGAAGGAAGG + Intronic
1179908728 21:44437060-44437082 AGGTGGAGGCGGAACGAGGATGG + Exonic
1180094756 21:45550858-45550880 AGGCGGAGGAGAGGGGAGGAAGG - Intergenic
1180678681 22:17607636-17607658 ATGTGGAGTAGAAACAAGGAGGG - Intronic
1181282231 22:21728194-21728216 AGGTGGAGAAGCTGTGGGGACGG - Intronic
1181546522 22:23605534-23605556 AGGGGGAGAGGAAGGGAGAAAGG + Intergenic
1181626766 22:24127419-24127441 AGGTGGAGAAGAAGTCAGTGTGG + Intronic
1181856952 22:25788712-25788734 AGGAGGAGAAGGAAGGAGGAGGG - Intronic
1181912862 22:26254342-26254364 AGGAAGAGGAGAAGTGAGGAAGG + Intronic
1182005617 22:26957036-26957058 AGGAGGAGAAGCTGCGAGAAGGG - Intergenic
1182099242 22:27646174-27646196 AGGTGGAGAAGAAGGTGTGAGGG + Intergenic
1182116788 22:27761337-27761359 AGGGGGAGAAGGAGAGAGGGAGG - Intronic
1182574948 22:31266724-31266746 AAGTGGGGAAGAAGGCAGGAGGG - Intronic
1182670754 22:31993820-31993842 AGCTGGAGGAGAGGCCAGGAAGG - Intergenic
1182779976 22:32859731-32859753 AGGTGGGGAAGAAGCAAGAGGGG - Exonic
1182931468 22:34178288-34178310 AGGGGGAGGAGGAGGGAGGAGGG - Intergenic
1183082048 22:35462988-35463010 AGGTGGAGGAGAAGGGAAGGAGG - Intergenic
1183085406 22:35483783-35483805 GGGAGGGGAAGAAGAGAGGAAGG + Intergenic
1183286573 22:36968740-36968762 AGGAGGGGAAGAAGGAAGGAAGG - Intergenic
1183307500 22:37090400-37090422 ATGAGGAGAAGAAGGGATGAGGG + Intronic
1183381247 22:37491592-37491614 AGGGGGAGAAGGAGGGGGGAGGG + Intronic
1183469321 22:37997228-37997250 AAGTGGAAAAGAAGGGAGAAAGG - Intronic
1183641425 22:39095246-39095268 AGGCTGAGAAGCAGGGAGGATGG - Intergenic
1184255020 22:43281640-43281662 AGGGGGAGACGACGGGAGGATGG - Intronic
1184344976 22:43907620-43907642 ATGTGGAGAAGATGCAGGGATGG + Intergenic
1184449693 22:44575670-44575692 AGGAGGAGAAGAAGAAAGAAGGG + Intergenic
1184672552 22:46023027-46023049 AGGAGGAGAAGAAAGGAGGAAGG + Intergenic
1185408588 22:50671522-50671544 AGGTGGGGAAGAAGTGGGGATGG + Intergenic
949166636 3:950623-950645 AGGAGAAGGAGAAGCAAGGAAGG - Intergenic
949457107 3:4250309-4250331 AGGGAGAGAAGAAGGGAGGGAGG + Intronic
949649152 3:6134986-6135008 AGGTGGAGTAGAGGGGAGGGAGG - Intergenic
949994558 3:9606255-9606277 GGGAGGAGAAGAAGCCAAGAGGG - Intergenic
950246910 3:11428982-11429004 TGGTGGAGCAGAAGGGAGCATGG + Intronic
950314231 3:11986450-11986472 AGGTGGAGAGGAAATGGGGAAGG - Intergenic
950404107 3:12793976-12793998 AGGAGGGGAGGAAGGGAGGAAGG - Intergenic
950507992 3:13407580-13407602 AGGTGGAGAAGCTGGGAGGGAGG - Intronic
951405381 3:22290448-22290470 GGTTGGAGAAGAAGCTGGGAAGG + Intronic
951801220 3:26598122-26598144 AGGTGGAGAAGAAGCTGAGAAGG + Intergenic
951816891 3:26763999-26764021 AGGAGGAAAAGAAGGAAGGAAGG + Intergenic
951984100 3:28598670-28598692 AGGAAGAGAAGAAACGAAGAGGG + Intergenic
952003335 3:28810853-28810875 AGGTGGATAGGGAGCCAGGAGGG + Intergenic
952261946 3:31748499-31748521 AGCTGGAGGAAAAGCAAGGAGGG - Intronic
952344482 3:32471053-32471075 AGGAGGAGAGGAGGAGAGGAGGG + Intronic
952404084 3:32990239-32990261 AGGTGAAGAATAAGAGAAGAAGG - Intergenic
952507187 3:34017980-34018002 AGGAAGAGAGGAAGGGAGGAAGG - Intergenic
952641001 3:35595928-35595950 AGGATGAGAAGAAAGGAGGAAGG + Intergenic
952708290 3:36402291-36402313 AGGGGAAGAAGAAGGAAGGAAGG + Intronic
953031071 3:39180382-39180404 AGGTGGAGAAGAAGGCAGAGAGG + Intergenic
953140555 3:40225752-40225774 GGGAAGAGAAGAAGCAAGGAGGG - Intronic
953434238 3:42865931-42865953 AGGAAGGGAAGAAGCGAGGGAGG - Exonic
953484068 3:43277961-43277983 AGGAGGAGGAGAAGGAAGGAAGG + Intergenic
954426680 3:50447108-50447130 AGGTGAAGAAGAAGGAAGGCTGG + Intronic
954670672 3:52289862-52289884 AGGTGGTAAAGAGGCAAGGAAGG + Intronic
954999199 3:54911312-54911334 GGGAGGAGGAGAAGCGGGGAGGG - Intronic
955535990 3:59924251-59924273 AAGAGGAGAAGAAGAAAGGATGG - Intronic
955874604 3:63476246-63476268 AGGGAGAGAAGAAGGAAGGAAGG + Intronic
955874647 3:63476379-63476401 AGGGAGAGAAGAAGGAAGGAAGG + Intronic
956134478 3:66085450-66085472 AGGAGGAGGAGAAGGGAGGATGG - Intergenic
956162558 3:66370622-66370644 TGGTGGAGAGGAAGAAAGGAAGG - Intronic
956594534 3:70951330-70951352 TGGTGGAGTAGCAGTGAGGAAGG + Intergenic
956839740 3:73127167-73127189 AAGTGCAGAAGAATGGAGGAAGG - Intergenic
956968250 3:74489455-74489477 AGGGAGAGAGGAAGGGAGGAAGG - Intronic
957047337 3:75386189-75386211 AGAAGGAGAAGAAGGAAGGAAGG + Intergenic
957175576 3:76803486-76803508 AGGGAGAGAGGAAGGGAGGAGGG + Intronic
957467140 3:80608351-80608373 AGGTAGAGAGGAAGGAAGGAAGG + Intergenic
957467152 3:80608415-80608437 AGGTAGAGAGGAAGGAAGGAAGG + Intergenic
957850869 3:85806153-85806175 AGGAAGAAAAGAAGCGAGGGAGG + Intronic
958157758 3:89776130-89776152 AGGAGGAGAGGAAGGAAGGAAGG - Intergenic
958556116 3:95679042-95679064 AGGAAGAGAGGAAGGGAGGAAGG + Intergenic
959991029 3:112632566-112632588 AGGGGGAGAAGACTAGAGGAGGG - Intronic
960253506 3:115484969-115484991 AGGGTGAGAAGAAGCAAGAAAGG + Intergenic
960488579 3:118282425-118282447 ATGTGGGGAAGATGCTAGGAGGG - Intergenic
961345308 3:126260187-126260209 AGGGGGAAGAGAAGGGAGGAAGG - Intergenic
961507883 3:127383423-127383445 AGGTGGAGAGGATGAGAGAAAGG - Intergenic
961741948 3:129038683-129038705 AGGGGGCCAAGAAGCGATGAGGG + Intronic
961863175 3:129934238-129934260 TGATGGAGAATAAGGGAGGAAGG - Intergenic
961879407 3:130050285-130050307 AGAAGGAGAAGAAGGAAGGAAGG + Intergenic
961951009 3:130749076-130749098 AGATGGAGAAGAAGGGAGGAGGG - Intergenic
962416874 3:135191134-135191156 AGAGGGAGAAAAAGGGAGGAAGG + Intronic
962769691 3:138600905-138600927 AGGAGGAGAAGGAGGGAGGAGGG + Intergenic
962769701 3:138600930-138600952 AGGAGGAGAAGGAGGGAGGAGGG + Intergenic
962795361 3:138845204-138845226 AGCAGGAGAGGAAGGGAGGAAGG + Intergenic
962865922 3:139448013-139448035 AGGTGAAGAGGAAGGGATGAGGG - Intergenic
962962700 3:140325727-140325749 AGGTAGAGGAGAAGAAAGGAAGG - Intronic
963185857 3:142416101-142416123 AGGTGAAGAAGAAAAGAGAAAGG - Intronic
963260402 3:143186421-143186443 AGGGGGAGAAGAACCAAGGAAGG + Intergenic
963615373 3:147530058-147530080 AGGAGGAGATGAAGAGAGGTTGG + Intergenic
963652925 3:148006924-148006946 AGGAGGAGAGGGAGGGAGGAAGG - Intergenic
963872069 3:150427797-150427819 AGGAAGAGAAGAAGAAAGGAAGG - Intronic
963931797 3:151011127-151011149 AAGTGGAGAAGGTGGGAGGAGGG + Intergenic
964011847 3:151901093-151901115 GGGTGGAGAAGTAGAGAGTAAGG - Intergenic
964178747 3:153857613-153857635 AGGAAGGGAAGAAGGGAGGAAGG + Intergenic
965095680 3:164222023-164222045 AGGTGGTGGAGAAGGGGGGAGGG - Intergenic
965359191 3:167716278-167716300 GGGTGGAGAAGAAGTGAGGATGG + Intronic
965721813 3:171670147-171670169 GGGTGGAGATAAAGAGAGGATGG + Intronic
965970829 3:174554504-174554526 AGGTGGGAAAGAAGAAAGGAAGG - Intronic
966079042 3:175977567-175977589 AGGTGGAAAGGAGGCCAGGATGG + Intergenic
966087357 3:176084743-176084765 AGGAGGAGGAGGAGGGAGGAAGG + Intergenic
966317517 3:178664724-178664746 AGGGAGAGAAGGAGGGAGGAAGG + Intronic
967523388 3:190462529-190462551 ATGTGGAGAAGAAACAAGAATGG - Intergenic
967838116 3:193981396-193981418 AAGTGGAGAGGAAGGAAGGAGGG - Intergenic
967845678 3:194040847-194040869 ATGTGGAGAAGCAGCCAAGAGGG + Intergenic
968546237 4:1200429-1200451 AGGTGCAGGCTAAGCGAGGATGG + Intronic
968612142 4:1562150-1562172 AGGTGGAGAGGGAGCGCGGAAGG - Intergenic
968967890 4:3778542-3778564 AGGTGAAGACGGAGCGAAGATGG - Intergenic
969232960 4:5844413-5844435 GGAGGGAGAAGAGGCGAGGAAGG + Intronic
969607837 4:8211302-8211324 AGGGGGAGAAGGAGGGAGGAGGG - Intronic
969823716 4:9740259-9740281 AGAAGGAGAAGAAGGAAGGAAGG - Intergenic
969912571 4:10459400-10459422 GGGTGGAGAAGAAGACATGAAGG - Intergenic
970143333 4:13006938-13006960 AGATGCAGAAGAAGCAAGTAAGG - Intergenic
970254258 4:14151014-14151036 ATCTTGAGAAGAAGAGAGGAAGG + Intergenic
970341851 4:15115679-15115701 AGGAGGAGGAGAAGGAAGGAAGG - Intergenic
970444503 4:16112666-16112688 GGGTGGAGGAGAGGGGAGGAGGG + Intergenic
970777179 4:19689318-19689340 AGGAGGAAAGGAAGGGAGGAAGG - Intergenic
970891721 4:21052933-21052955 AGGGGGAGAAGAAGTGGAGAGGG + Intronic
971103650 4:23497613-23497635 AGGAGGAGGAGAAGGAAGGAAGG + Intergenic
971175709 4:24280485-24280507 AGGGAGAGAAGAAGAAAGGAAGG + Intergenic
971443890 4:26721361-26721383 AGGTGGAGAGAAATCTAGGATGG - Intronic
971709677 4:30094357-30094379 AGGGAGGGAAGAAGAGAGGAAGG + Intergenic
971861169 4:32108092-32108114 AGGTAGAGAAGAAGGAAGGAAGG + Intergenic
972281493 4:37606121-37606143 AGGAGGAGGAGAAGGAAGGAAGG + Intronic
972305374 4:37825601-37825623 AGGTGGGGGAGAAGCTGGGAAGG - Intergenic
972335673 4:38105582-38105604 GGGTGGAGAGGGAGGGAGGAAGG - Intronic
972626133 4:40801026-40801048 AGGAGGAGAGGAAGGGAGAAAGG + Intronic
972779775 4:42276901-42276923 AGGTGGAGAGGCAGAGTGGAGGG + Intergenic
973779058 4:54271565-54271587 AGGGAGAGAAGAAGGAAGGAAGG - Intronic
973833772 4:54789098-54789120 AGGAGGGGAAGGAGAGAGGAGGG - Intergenic
973918567 4:55661695-55661717 AGGTGGGGAAGAACAGATGAAGG + Intergenic
974020439 4:56687971-56687993 AGGTGGAGAGGAAGGAAGGAAGG + Intergenic
974020474 4:56688090-56688112 ATGAGGAGAAGAAGGAAGGAAGG + Intergenic
974020508 4:56688194-56688216 AGGTGGAGAGGAAAGAAGGAAGG + Intergenic
974020520 4:56688229-56688251 AGGGAGAGAAGGAGGGAGGAAGG + Intergenic
974522188 4:62996066-62996088 AGGGAGAGAAGAAGGAAGGAAGG + Intergenic
974718159 4:65698661-65698683 AGGAGGAGAGGAAGGAAGGAAGG - Intergenic
975411440 4:74055893-74055915 AAGTTTAGAAGAAGAGAGGAAGG - Intergenic
975536922 4:75460707-75460729 AAGTGGAGAGGGAGGGAGGAAGG + Intergenic
976094019 4:81488624-81488646 AGAGAGAGAAGAAGCAAGGAAGG - Intronic
976775162 4:88698898-88698920 AGGTGGGGAAGAAGAGGGTAAGG - Intronic
977064690 4:92299845-92299867 AGGGAGAGATGAAGAGAGGAAGG + Intronic
977555896 4:98487123-98487145 AGGAAGGGAGGAAGCGAGGAAGG + Intronic
977713822 4:100158498-100158520 AGGAAGAGAAGAAGGGAGGGAGG - Intergenic
978621405 4:110637361-110637383 AGGAGGACCAGAAGGGAGGATGG + Intronic
978733926 4:112063661-112063683 GGGTGGGGAAGAAGTGGGGATGG + Intergenic
978737211 4:112097500-112097522 AGGTGGGGAGGAAGGGAGGGAGG + Intergenic
979481631 4:121225753-121225775 AGGTAGAGAAGGAGTGAGAAGGG - Intronic
979768387 4:124491109-124491131 AGGAGGAGAAGAAGAAAGGGGGG + Intergenic
979787363 4:124733020-124733042 AGGTGAAGGAGAAGCGAGGCAGG - Intergenic
979927118 4:126581832-126581854 AGAAGGAGAGGAAGCAAGGATGG + Intergenic
979994356 4:127412550-127412572 AGGTGGGGAAGGAGGGAGGAGGG + Intergenic
980098852 4:128521201-128521223 GGGTGGAGAGGAAGAGAGGAAGG - Intergenic
981056293 4:140365595-140365617 TGGAGGAGAAAAAGGGAGGAAGG - Intronic
982833630 4:160094453-160094475 AGGGAGAGAAGAAGAGAGGGAGG - Intergenic
983309376 4:166038209-166038231 AGGCAGAGAAGGAGAGAGGAAGG - Intronic
983631398 4:169853133-169853155 AGGAGGGGAAAAAGAGAGGAAGG - Intergenic
983858972 4:172680665-172680687 AGGGGGAGAAGAAAAGAAGACGG - Intronic
984762847 4:183377357-183377379 AGGGAGAGAAGAAGGAAGGAAGG - Intergenic
984844728 4:184099698-184099720 AGCTGGAGAAGGAGGGACGAGGG - Intronic
984975693 4:185228268-185228290 AGATGGAAAAGTAGAGAGGAAGG + Intronic
985163812 4:187071505-187071527 AGGAGGAGAGGAAGGAAGGAAGG - Intergenic
985168817 4:187126736-187126758 AGGGGGGAAAGAAGGGAGGAAGG - Intergenic
985230095 4:187806321-187806343 CGGTGGGGAGGAAGTGAGGATGG + Intergenic
985616566 5:926586-926608 GGGCGGGGAAGAAGCGCGGACGG - Intergenic
985627223 5:995355-995377 AGGTGGAGAGGGGGCGATGAGGG - Intergenic
985665988 5:1181724-1181746 TGGTGGAGGGGAAGGGAGGAGGG + Intergenic
986009651 5:3700703-3700725 AGGAGGAGAAGAAGAAAAGAAGG - Intergenic
986618276 5:9642922-9642944 AGGGAGGGAAGAAGCAAGGAAGG - Intronic
986708743 5:10472119-10472141 AGGAGGAGAAGTTGGGAGGAAGG + Intergenic
986759792 5:10869475-10869497 AGGTAGAGAGGAAGGAAGGAGGG - Intergenic
986765730 5:10924317-10924339 ATGTGGAGCAGGAGTGAGGAGGG - Intergenic
987173647 5:15284879-15284901 AGAGGCAGAAGAAGCCAGGAAGG - Intergenic
987213367 5:15707613-15707635 AGGAGGAGCAGAAGCTTGGAAGG + Intronic
988031083 5:25763222-25763244 AGGTGGTGAAGAGGGAAGGAGGG + Intergenic
988427786 5:31083691-31083713 AGGAGGAGGAGAAGAAAGGAAGG + Intergenic
988430611 5:31114713-31114735 AGCTGGAGAAGAAGTGAGGAAGG + Intergenic
988548197 5:32176706-32176728 AGCTGGGGAAGAAGTGAGGGAGG + Intergenic
988671264 5:33384646-33384668 GGCTGGAGAAGAAGCAAGGCGGG + Intergenic
988836473 5:35037523-35037545 AGGAGGGGAGGAAGGGAGGAAGG - Intronic
989225646 5:39025130-39025152 AGGAGGAGAAGGAGGGAGAAAGG - Intronic
990640799 5:57781544-57781566 AGAGGCAGAAGAAGCCAGGAAGG - Intergenic
990654428 5:57939562-57939584 AAGTGGGGAGGAAGTGAGGAGGG - Intergenic
990852927 5:60227570-60227592 AGGAGGAGAGGAAAGGAGGAAGG + Intronic
991418747 5:66418875-66418897 AGGAGGAGGAGGAGAGAGGAGGG - Intergenic
991930792 5:71750784-71750806 AGAAGGAGAAGAAGAGAGGGGGG - Intergenic
991978992 5:72212138-72212160 ACATGGAGAATAAGCTAGGAGGG - Intergenic
992071718 5:73154766-73154788 AGGGAGAGAGGAAGGGAGGAAGG - Intergenic
992090634 5:73312899-73312921 AGGAGGAGAAGAAGAGGAGAAGG - Intergenic
993375063 5:87141090-87141112 AGGGGGAGAGGGAGGGAGGAAGG + Intergenic
993541544 5:89159023-89159045 AGGTCGAGCAGAAGCAAGGTGGG + Intergenic
994469903 5:100190132-100190154 AGATAGAGAAGAAGCGCAGATGG - Intergenic
994628547 5:102252079-102252101 AGGAAGGGAAGAAGGGAGGAAGG + Intronic
994648176 5:102495768-102495790 AAAGGGAGAAGAAGAGAGGAAGG + Intronic
995306779 5:110660968-110660990 AAGTGGGGAAGAAGAGAGGTTGG - Intronic
996229042 5:121038792-121038814 AGATGTAGACGAAGAGAGGAAGG + Intergenic
996485328 5:124026904-124026926 AGGGGGAGAAGAATAGAGGAAGG + Intergenic
996562211 5:124843096-124843118 AGGTGGTTAAGGAGCGAGGAGGG + Intergenic
997055586 5:130439297-130439319 AGGGTGATAAGAAGCAAGGAAGG - Intergenic
997777277 5:136621967-136621989 AGGAGGAGAAGAAGGGAAGAAGG - Intergenic
998003246 5:138640724-138640746 AGGTGGAGGTGAGGGGAGGAGGG + Intronic
998091064 5:139369904-139369926 AGGTGATTAAGAAGCAAGGATGG - Intronic
998393613 5:141804092-141804114 AGAGAGAGAAGAAGGGAGGAAGG - Intergenic
998704339 5:144741247-144741269 AGGAAGAGAGGAAGGGAGGAAGG - Intergenic
999236211 5:150097318-150097340 AGGGGAAGGAGAAGGGAGGAAGG + Intronic
999265218 5:150262537-150262559 ATGTGCAGGAGAAGTGAGGATGG - Intronic
999268806 5:150284487-150284509 AGGTGGGGAGGAAGGGAGGGAGG + Intronic
999298241 5:150474064-150474086 AGTTGCAGAAGAAGGGAGGTGGG + Intergenic
999445309 5:151634040-151634062 AGGATGAGAAGAAGCCAGCAGGG + Intergenic
999676777 5:154012073-154012095 AGGCGGAAAAGAAGAGAGGCAGG + Intronic
1000194300 5:158942980-158943002 AGGAAGAGAGGAAGGGAGGAAGG + Intronic
1000222555 5:159227850-159227872 AGGGAGAGAAGAAGCAAGGGAGG - Intergenic
1000357929 5:160418890-160418912 AGGTGTTGAGGGAGCGAGGACGG - Intronic
1000360989 5:160447368-160447390 AGGAAGAGAAGAAGGGAGGGAGG - Intergenic
1000798868 5:165699102-165699124 AGGTCAAGGAGAAGCAAGGATGG + Intergenic
1000996234 5:167961506-167961528 AGATGAAGAAGAAGAAAGGAAGG + Intronic
1001251857 5:170152851-170152873 ATCTGGAGAGGAAGAGAGGAGGG - Intergenic
1001545353 5:172567682-172567704 GGGAGGAGAGGAAGGGAGGAAGG - Intergenic
1001684529 5:173583611-173583633 AGGAGAAGAGGAAGGGAGGAAGG + Intergenic
1001749865 5:174120670-174120692 AGGTGGAGCAGACCCCAGGATGG - Intronic
1001769930 5:174286923-174286945 GGGTGGTGAAGAAGTGAGGGAGG + Intergenic
1002048731 5:176556966-176556988 AGGAAGAGAGGAAGGGAGGAAGG - Intronic
1002173093 5:177386119-177386141 AGGAGGAGCAGAAGCCAGGTGGG + Exonic
1002301231 5:178258297-178258319 AAGTGGAGAAGAGAAGAGGATGG + Intronic
1003075847 6:2983124-2983146 AGGAGGAAAAGAAGAAAGGATGG - Intergenic
1003487863 6:6595283-6595305 AGGTGGGGAAGAAGAGGAGAAGG + Intronic
1003681612 6:8263134-8263156 AGGAGGAGAGGAAGGAAGGAAGG - Intergenic
1004577036 6:16906897-16906919 AGGAGGAGAGGAAGGAAGGAAGG + Intergenic
1004761407 6:18670782-18670804 AGGAAGAGAAGGAGGGAGGAAGG - Intergenic
1005143630 6:22662822-22662844 ATGTGGAGAGGAAGAGAGGAAGG + Intergenic
1005187921 6:23183515-23183537 AGGAAGGGAAGAAGGGAGGAAGG - Intergenic
1005224335 6:23623514-23623536 AGGGAGAGAGGAAGGGAGGAAGG + Intergenic
1005224365 6:23623618-23623640 AGGGGGGAAAGAAGAGAGGAAGG + Intergenic
1005579991 6:27224734-27224756 AGGTGGAGAATGAGGGAGTAGGG - Intergenic
1005743456 6:28814305-28814327 AGGCGGAGGAGAAGCGAAGTGGG + Intergenic
1005826190 6:29632922-29632944 AGGTGGAGGAGAAGGGAGGGGGG - Exonic
1006179588 6:32146830-32146852 GGGAGGAGAAAAAGCAAGGAGGG + Intergenic
1006191023 6:32209361-32209383 AGGGGGAGATGAAGAGAGGTTGG + Intronic
1006216595 6:32449118-32449140 AGGGAGGGAAGAAGCAAGGAAGG + Intergenic
1006302787 6:33202614-33202636 GGGTTCAGAAGAGGCGAGGAGGG + Exonic
1006666419 6:35697723-35697745 AGGTGTAGGAGAGGGGAGGATGG + Intronic
1006744137 6:36329891-36329913 AGGAGGAGAGGAAGGAAGGAAGG + Intronic
1007303532 6:40886882-40886904 AGAGGGAGAAGAGGAGAGGAGGG + Intergenic
1007378093 6:41469987-41470009 AGGTGGGGAAGAGGCAAGGAAGG + Intergenic
1007437111 6:41822226-41822248 ATGTGGAGAAAATGGGAGGAGGG - Intronic
1007972290 6:46064730-46064752 AGGAAGAGAAGAAGGGAGGGAGG + Intronic
1008265161 6:49416126-49416148 ACGTGCACAAGAAGCTAGGATGG - Intergenic
1008288421 6:49682839-49682861 AGGAAGAAAAGAAGGGAGGAAGG - Intergenic
1008813885 6:55539931-55539953 AGGAGGAGGAGAAGGAAGGAAGG + Intronic
1009006287 6:57792651-57792673 GAGTGGAAAAGAAGGGAGGATGG + Intergenic
1009411749 6:63373441-63373463 TGGTGGAGGAGAAGCGGGTAAGG - Intergenic
1010475155 6:76277521-76277543 AGGGGGAGATGAAGAGAGGTTGG - Intergenic
1010630791 6:78195485-78195507 AGGAAGGGAAGAAGGGAGGAAGG - Intergenic
1010751340 6:79619176-79619198 AGGTGGAGAGGAATAGAGGCAGG - Intergenic
1010907903 6:81515435-81515457 AGGTGGGGAAGAAGTCAGGAGGG - Intronic
1011036878 6:82986932-82986954 AGGAAGAGAGGAAGGGAGGAAGG - Intronic
1011175908 6:84559941-84559963 AGTTGGAGAAGGAGAGAGGAAGG - Intergenic
1011546097 6:88483067-88483089 AGGGGGATGAGAAGAGAGGAGGG + Intergenic
1011695750 6:89911269-89911291 AAGAGGAAAAGAAGGGAGGAAGG - Intergenic
1012017624 6:93871765-93871787 ATGTGGAGAAGGAGCCAAGATGG - Intergenic
1012072270 6:94637941-94637963 AGGGAGAGAGGAAGCAAGGAAGG + Intergenic
1012165680 6:95948102-95948124 AGGAGGAGGAGAAAGGAGGAAGG + Intergenic
1012370705 6:98503303-98503325 AGGAGGAGAAGAGGGAAGGAAGG - Intergenic
1012752965 6:103185765-103185787 AGGAAGGGAAGAAGGGAGGAGGG + Intergenic
1012964150 6:105655507-105655529 AGGTGGTGAGGACGTGAGGATGG - Intergenic
1013175317 6:107671352-107671374 AGGAGCTGAGGAAGCGAGGACGG + Intergenic
1013459973 6:110365476-110365498 AGGAGGAAAAGAAGGAAGGAAGG - Intergenic
1014999179 6:128192903-128192925 AGGAAGAGAAGAAGGGAGAAAGG + Intronic
1016068650 6:139710708-139710730 GGGTGGAGTAGAAGCAAGGAAGG + Intergenic
1016123965 6:140376419-140376441 AGGGAGAGAAGAAGGAAGGAAGG - Intergenic
1016428063 6:143955472-143955494 ATGTGGAGATGCAGTGAGGAGGG + Intronic
1016510184 6:144833982-144834004 AGGACGAGAAGAAGAGAGTATGG - Intronic
1016804964 6:148203365-148203387 AGGGAGAGAAGACGGGAGGATGG - Intergenic
1017099154 6:150832173-150832195 TGGAAGAGAAGAAGCAAGGAGGG + Exonic
1017385777 6:153880961-153880983 AGGTAGAGAAGAAGAGAGATTGG + Intergenic
1017426897 6:154331316-154331338 AGAAGAAGAAGAAGGGAGGAAGG + Intronic
1017512646 6:155128050-155128072 AGGGGGAGAAGGAGGGAGGGAGG - Intronic
1017576179 6:155807217-155807239 AGGGGAAGAAGAAGAGAGGAGGG + Intergenic
1017654567 6:156615054-156615076 AGGTGAAGGAGAAGCAAGGCAGG + Intergenic
1017751021 6:157490722-157490744 AGTGGGTGAAGAAGCGGGGAGGG + Intronic
1018038109 6:159898776-159898798 AGAAGGAGAAGAAGGGAGAAGGG - Intergenic
1018908680 6:168089499-168089521 AGGTGGAGGAGGACCGAGGCAGG + Intergenic
1019162325 6:170076858-170076880 CTGTGGGGAAGAAGAGAGGAGGG - Intergenic
1019223493 6:170493232-170493254 AGGAGGAGAGGAGGTGAGGAGGG + Intergenic
1019224569 6:170499645-170499667 GCGTGGAGAGGGAGCGAGGAAGG + Intergenic
1019266765 7:121526-121548 AGGTGGAGAGGAAGGGAGGAGGG + Intergenic
1019494925 7:1333366-1333388 AGGGGGAGGAGGAGAGAGGAGGG - Intergenic
1019494965 7:1333456-1333478 AGGGGGAGGAGGAGGGAGGAGGG - Intergenic
1019511413 7:1419469-1419491 AGGTGGAGAAGAGCAGAGGCCGG - Intergenic
1019799010 7:3074006-3074028 AGGAGGAGAAGGAGAGAGGCTGG - Intergenic
1019843205 7:3470199-3470221 AGGGAGAGAAGAAGGGAGAAAGG - Intronic
1020942577 7:14559924-14559946 AGGAAGAGAGGAAGGGAGGAAGG - Intronic
1020988150 7:15162144-15162166 AGGTGAAGGAGAAGCAAGGCAGG - Intergenic
1021209700 7:17832916-17832938 AGGTGGAGGAGAGGGGAGGCTGG + Intronic
1021717159 7:23470559-23470581 AGGAGGAGGAGGAGGGAGGAAGG + Intergenic
1021738095 7:23658673-23658695 AGGTGGAGAAGAACTAAGGGAGG - Intergenic
1022333769 7:29403645-29403667 AGATGGAGAGGCAGGGAGGAAGG + Intronic
1022381339 7:29862806-29862828 AGGTGGGGAAGAAGAGAAGAGGG - Intronic
1022540328 7:31128957-31128979 CTGTGGAGAAAAAGGGAGGAGGG - Intergenic
1022789457 7:33672455-33672477 AGGAAGGGAAGAAGGGAGGAAGG - Intergenic
1022929929 7:35100575-35100597 GGGTGGAGGGGAAGTGAGGATGG + Intergenic
1023805848 7:43872443-43872465 AAGGGCAGAAGAAGGGAGGAGGG + Intronic
1024049126 7:45607403-45607425 AGCAGGAGAAGAAGGGAAGAGGG + Intronic
1024144936 7:46504653-46504675 AGGAGGAGAGGAAGGGAGGAAGG + Intergenic
1024250276 7:47501134-47501156 AGGAAGAGAGGAAGGGAGGAAGG + Intronic
1024263637 7:47590098-47590120 GGGGGGAGAAGAAGGGAAGATGG - Intergenic
1025253598 7:57368358-57368380 AGGTGGGGGAGAAGCTGGGAAGG - Intergenic
1025321671 7:58100717-58100739 AAGAGGAAAAGAAGCAAGGAAGG + Intergenic
1025556792 7:62319256-62319278 AGGAGGGGAGGAAGGGAGGAAGG - Intergenic
1025924303 7:65944421-65944443 AGGTGGAGATGAAACAAGAAAGG + Intronic
1025931677 7:65999941-65999963 AGGTGGAGATGAAACAAGAAAGG + Intergenic
1026057277 7:66995614-66995636 AGGTGGAGCAGAAGCCGGGAGGG + Intronic
1026231165 7:68485345-68485367 AGGGAGGGAAGAAGAGAGGAAGG + Intergenic
1026455718 7:70570910-70570932 AGGTGGAGAAGAAACAAAGCAGG - Intronic
1026673232 7:72407525-72407547 AGCAGGAGGAGAAGAGAGGAGGG - Intronic
1026720837 7:72829437-72829459 AGGTGGAGCAGAAGCCGGGAGGG - Intergenic
1026955054 7:74371755-74371777 GGGAGGAGAAGGAGAGAGGAGGG + Intronic
1027389643 7:77692172-77692194 AGGTGGAGAAGCAGGGTGTAGGG + Intergenic
1028086609 7:86644548-86644570 GGGTGGAGTAGAAGAGAGGGAGG - Exonic
1028826598 7:95280824-95280846 AGGAGGAGAAGAAGAAAGGGAGG + Intronic
1028838170 7:95396984-95397006 AAGAGGAGCAGAGGCGAGGAAGG + Intergenic
1029574965 7:101397360-101397382 AGATGAAGAAGAAGGAAGGAAGG - Intronic
1029825823 7:103193019-103193041 GGGTGGAGGGGAAGTGAGGATGG + Intergenic
1030121375 7:106113202-106113224 AGGTACTGAAGAAGCCAGGAAGG - Intergenic
1030198954 7:106882447-106882469 AGATGGAGAAGGAAAGAGGAGGG - Intronic
1030386392 7:108872469-108872491 AGGTTGGAAAGAAGCAAGGAAGG - Intergenic
1030488017 7:110195575-110195597 GGGTGGAGCAGAAGTGAGCATGG - Intergenic
1030497255 7:110315468-110315490 AGGAAGAGAAGGAGGGAGGAAGG + Intergenic
1030642371 7:112021009-112021031 AGGTGGAGGCCAAGTGAGGATGG + Intronic
1030862902 7:114658814-114658836 AGGTGGGGGAGAAGGGAGAAGGG - Intronic
1031716421 7:125114143-125114165 AGGCAGAAAAGAAGAGAGGAGGG + Intergenic
1031989282 7:128186447-128186469 AGGAAGAGAAGAAGGGAGGAAGG - Intergenic
1032396692 7:131595171-131595193 AGGTAGAGAGGAAGGGAGAATGG - Intergenic
1032523310 7:132562086-132562108 AGGAGGAGGAGAAAGGAGGAGGG - Intronic
1032669389 7:134069379-134069401 AGGGGGAGAAGAGGCGGAGAAGG - Intergenic
1032695537 7:134332907-134332929 AGGAGGAGGAGAGGCGGGGAGGG - Intergenic
1032978627 7:137254766-137254788 AGGCAGAGTAGAAGAGAGGAAGG + Intronic
1033023827 7:137753964-137753986 AGGAGGAGGAGGAGCGTGGAGGG + Intronic
1033159010 7:138980975-138980997 AGCTGGAGAATAAAAGAGGATGG + Intronic
1033478659 7:141716358-141716380 GGGTAGGGAAGAAGGGAGGAGGG - Intronic
1033604859 7:142919418-142919440 AGGAGGACAGGAAGCGGGGATGG + Intronic
1034203460 7:149296421-149296443 AGGTTGAGCAGAAGGGAGGTAGG + Intronic
1035274280 7:157737989-157738011 AGATGGATGAGAAGAGAGGAGGG - Intronic
1035284727 7:157799009-157799031 AGTTGGAGAAGAAAGGAGGAGGG - Intronic
1035351173 7:158247341-158247363 AGGTGGGGAAGTGGGGAGGAGGG + Intronic
1035834156 8:2730375-2730397 AGGAGAAGAAAAAGCCAGGAAGG + Intergenic
1035977056 8:4324378-4324400 AGGTGGGGCAGGAGCAAGGAGGG + Intronic
1036338407 8:7893798-7893820 TGGTGGAGAAGCACCGAGTAGGG - Intergenic
1036524122 8:9519199-9519221 AAATGCAGAAGAAACGAGGAAGG - Intergenic
1037460632 8:19104938-19104960 AGGGAGAGAAGAAGAAAGGAGGG + Intergenic
1037480627 8:19302116-19302138 AGGTAGAAAGGAAGAGAGGAAGG + Intergenic
1037480661 8:19302256-19302278 AGGTAGAAAGGAAGAGAGGAAGG + Intergenic
1037691275 8:21183419-21183441 AGGAGGAGAAGAAGGGAATAAGG - Intergenic
1037901730 8:22692753-22692775 AGGCGGCGAGGCAGCGAGGAAGG - Intronic
1038325237 8:26567809-26567831 ATGGGGAGAAGAAGAGATGAAGG + Intronic
1038332075 8:26616867-26616889 ACGTGGAATAGAAGGGAGGAGGG - Intronic
1038644150 8:29349403-29349425 AGGTGGAGAAAAGGTGAAGAGGG - Intronic
1038646032 8:29363183-29363205 GGGTGGAGAAGGAACTAGGAGGG - Intergenic
1039003387 8:33006936-33006958 AGGTGGAGAAGGAATAAGGAAGG - Intergenic
1040399551 8:47034594-47034616 AGGAAGGGAAGAAGGGAGGAAGG + Intergenic
1040522781 8:48192756-48192778 AGGAGGAGAGGAGGAGAGGAAGG + Intergenic
1040522787 8:48192782-48192804 AGGAGGAGAGGAGGAGAGGAAGG + Intergenic
1041253398 8:55956875-55956897 AGGAGGAGAAGACAGGAGGAAGG + Intronic
1041273209 8:56129960-56129982 AGATGGAGAAGAAGGAAGGCAGG + Intergenic
1041421476 8:57671717-57671739 GGGTGGAGAAGCAGCTTGGAGGG + Intergenic
1041523463 8:58779736-58779758 AGGTGGAGATGAAGAGAAGTAGG - Intergenic
1041669130 8:60475483-60475505 AGGAGGAGAGGAGGGGAGGAAGG - Intergenic
1041669133 8:60475491-60475513 AGGTGAAGAGGAGGAGAGGAGGG - Intergenic
1042542373 8:69920050-69920072 AGGAGGAAAAGAAGTCAGGAAGG + Intergenic
1042572347 8:70179415-70179437 AGGAGGAAAAGAAGGGAGGAAGG + Intronic
1042637755 8:70897004-70897026 GGGTGAAGAAGAAGGGGGGATGG - Intergenic
1042664705 8:71192483-71192505 AGGTGGGGAGGAAGTGAGGGTGG + Intergenic
1042961390 8:74307168-74307190 AGGTAAAGATGAAGTGAGGAAGG - Intronic
1043472819 8:80578704-80578726 AGGAGGGGAAGAGGGGAGGAGGG - Intergenic
1043563933 8:81526987-81527009 AGGTGGGAAGAAAGCGAGGATGG + Intronic
1043880336 8:85535335-85535357 AGGCTAAGAAGAAGCAAGGAAGG - Intergenic
1043996063 8:86817972-86817994 ATGTGGATAAGAAGCAGGGAAGG + Intergenic
1044251603 8:90009175-90009197 GGCTGGAGAAGAAGGAAGGAGGG - Intronic
1044342164 8:91058522-91058544 AAGGGGAGAAGAAGGGAGCAAGG - Intergenic
1044590864 8:93913528-93913550 AGGTAGGGAAGGAGAGAGGAAGG - Intronic
1044810609 8:96057669-96057691 AGGGAGAGAGGAAGAGAGGAAGG + Intergenic
1045583081 8:103500317-103500339 GGGTCGTGAGGAAGCGAGGACGG - Intergenic
1045600752 8:103712999-103713021 AGGAGGAAAAGAAGGAAGGAAGG - Intronic
1045755208 8:105534007-105534029 AGGAAGGGAAGAAGGGAGGAAGG - Intronic
1047059171 8:121203845-121203867 TGGTGGGGAAGAAGACAGGATGG + Intergenic
1047244796 8:123132114-123132136 AGGAATAGAAAAAGCGAGGAAGG - Intronic
1047418102 8:124682399-124682421 AGGTGAAGAGGAAGCGTTGAAGG - Intronic
1047511906 8:125521876-125521898 AGGTAGGGAAGGAGCGAGGGAGG - Intergenic
1047708390 8:127525358-127525380 AGGTGGAGAAGGGGCAAGAATGG - Intergenic
1047782678 8:128122994-128123016 AGGGAGAGAAGGAGCGAGGCGGG - Intergenic
1048061451 8:130923234-130923256 AGAGGGAGAAGAAGTGACGAAGG + Intronic
1048268356 8:133007250-133007272 AGGGGGAGGAGAGGCGGGGACGG + Intronic
1048359680 8:133687206-133687228 AGGAGGAGAAGGAGGGAAGATGG - Intergenic
1048519691 8:135142079-135142101 AGGGAGAAAAGAAGCGGGGAAGG + Intergenic
1048705477 8:137148387-137148409 AGGTGGAGAGAAAGGGAGGCAGG - Intergenic
1048767415 8:137860003-137860025 AGGAGGAGAAAAATGGAGGAAGG + Intergenic
1048837863 8:138538310-138538332 GAGTGGAGAAGAAGGAAGGAAGG + Intergenic
1048949029 8:139477795-139477817 AGGGAGAGATGAAGGGAGGACGG - Intergenic
1049143932 8:140983715-140983737 AGGGAGAGAAGAAGGGAGGGAGG + Intronic
1049266107 8:141668681-141668703 AGGGCGAGCAGAAGTGAGGAAGG + Intergenic
1049356711 8:142192749-142192771 AGGGGGAGGAGCAGGGAGGAGGG + Intergenic
1049356756 8:142192896-142192918 AGGGGGAGGAGCAGGGAGGAGGG + Intergenic
1049361184 8:142213175-142213197 AGGGGGAGAGGAAGAGGGGAGGG - Intronic
1049469249 8:142768168-142768190 AGGAGGAGAGGAAGGAAGGAAGG + Intronic
1049609512 8:143547603-143547625 AGGTGGGGGAGAAGCTGGGAAGG - Intergenic
1049814455 8:144591639-144591661 TGGGGGAGCAGAGGCGAGGAAGG + Intronic
1050927973 9:11289553-11289575 AGGTAGAGAGGAAGGAAGGAAGG + Intergenic
1051164754 9:14249686-14249708 GAGGGGAGAAGAAGAGAGGAAGG + Intronic
1051420631 9:16885976-16885998 AGGTGAAAAAGAAGTGAGAAAGG + Intergenic
1051724436 9:20074540-20074562 AGGAAGAGAAGAAGGCAGGAAGG + Intergenic
1051784457 9:20726903-20726925 AGGAGAAGAAGAACCAAGGAAGG + Intronic
1052024596 9:23560554-23560576 AGGTGCAGAAGAGATGAGGAAGG - Intergenic
1052042854 9:23759395-23759417 GGGTGGAGAAGAGAGGAGGAAGG + Intronic
1052345363 9:27404062-27404084 AGGGGGAGATAAAGCGAGGAGGG - Intronic
1052353089 9:27476989-27477011 AGGTGAAGAAGACGGGAGGGAGG - Intronic
1052433979 9:28402598-28402620 AAGAGGAAAAGAAGAGAGGAAGG - Intronic
1052554278 9:29993685-29993707 AGGCGGAGCAGAAGTGAAGAGGG + Intergenic
1055228580 9:74031724-74031746 AGGAGGCGAGGAAGCAAGGAGGG + Intergenic
1055716414 9:79122781-79122803 AGGAGGAAAAGAAGGAAGGAAGG + Intergenic
1056595514 9:88004919-88004941 AGGGGGAGATGAAGGGGGGAAGG - Intergenic
1056688676 9:88787483-88787505 AGGTGGAGACAAAGCCAAGATGG - Intergenic
1056855595 9:90126687-90126709 AGGGAGAGAAAAAGCAAGGAGGG - Intergenic
1057176549 9:93004466-93004488 AGGTGGAGTATAAGCTAGGAGGG - Intronic
1057254584 9:93534614-93534636 AGAAGGAGAAGAGGAGAGGAGGG - Intronic
1057496277 9:95563902-95563924 AGGGAGAGAAGAAGGGAGGGAGG - Intergenic
1057565086 9:96160221-96160243 AGGGAGAGAAGAAGGAAGGAAGG + Intergenic
1057724313 9:97557382-97557404 AGGTGGGGCAGAACCCAGGAAGG + Intronic
1057953453 9:99388223-99388245 AGGAGGAAAAGAAGGAAGGAAGG - Intergenic
1058357628 9:104102818-104102840 ATGTGGAGAAAAAGCAGGGAAGG + Intronic
1058561425 9:106233098-106233120 AGGAGGAGGAGAAAAGAGGAAGG - Intergenic
1058618990 9:106863579-106863601 AGGAGGAGGAGAAGCGAGGGAGG + Intronic
1058638456 9:107059459-107059481 AGTAGGGGAGGAAGCGAGGAAGG + Intergenic
1058875856 9:109244310-109244332 AGTTTGAGAAGAAGGGATGAGGG + Intronic
1058887045 9:109329616-109329638 AGGGGGAGATGAAGGGAGGGAGG - Intergenic
1059352881 9:113678055-113678077 AGGAGGAGAGGAAGGAAGGAAGG - Intergenic
1059588333 9:115630174-115630196 AGGTGGAGAAAGAAAGAGGAAGG + Intergenic
1059710639 9:116864790-116864812 AGGTGGAGAAGAATGGGAGAAGG - Intronic
1059761687 9:117343943-117343965 AGGGAGAGAAGAAGGAAGGAGGG + Intronic
1060225362 9:121786930-121786952 GGGTGGAGAATGAGAGAGGAAGG - Intergenic
1060299107 9:122363663-122363685 AGAGGGAGAAGAAGAGAGGTGGG + Intergenic
1060671421 9:125473241-125473263 AGGTGGGGAAGAAAAGAGCACGG + Intronic
1060748772 9:126155129-126155151 AGGTTCAGCAGCAGCGAGGAGGG + Intergenic
1060772996 9:126346372-126346394 AGGTGGGGGAGTAGGGAGGAAGG + Intronic
1060918830 9:127406455-127406477 AGGAGGAAAAGAAGCCAAGAAGG + Intronic
1061366900 9:130176940-130176962 AGGAGAAGGAGAAGGGAGGAGGG - Intronic
1061477171 9:130875821-130875843 AGGAGAAGGAGAAGAGAGGAGGG - Intronic
1061489859 9:130938910-130938932 AGATTGAGAAGGAGGGAGGAGGG - Intronic
1061501464 9:131005431-131005453 AGGTGGAGGAGAACAAAGGAAGG - Intergenic
1061741259 9:132708170-132708192 AGAGGAAGAAGAAGGGAGGAAGG - Intergenic
1061777937 9:132978181-132978203 AGGAGGAGAAGGAGGGAGGGAGG + Intronic
1061785547 9:133025848-133025870 AGGTGGAGAGAAAGAGAGGGAGG - Intergenic
1061808633 9:133149760-133149782 AGGTGGGGAAGAGGAGGGGAAGG - Intergenic
1061909364 9:133714673-133714695 AGGAGGCGGAGAAGGGAGGATGG + Intronic
1062074763 9:134579830-134579852 AGGGGGAGAAGGAGCGGGGAGGG + Intergenic
1062082937 9:134634001-134634023 AGGGGGAGAAGAGTCCAGGATGG + Intergenic
1062113335 9:134794746-134794768 AGGAGGGGAAGGAGGGAGGAAGG + Intronic
1185915403 X:4028990-4029012 AGGTGGAGAAGTGGGAAGGAAGG + Intergenic
1185984585 X:4817629-4817651 AGGAGGAAAAGAAGAGAAGAAGG - Intergenic
1186239903 X:7555054-7555076 AGGAGGAAATGAAGAGAGGATGG + Intergenic
1186240382 X:7559195-7559217 AGGAAGAGAAGAAGGAAGGAAGG - Intergenic
1186471159 X:9823074-9823096 AGGAGGAGGAGAAGGGAGAAGGG - Intronic
1186587478 X:10890894-10890916 GGGTGGAGATGATGTGAGGAGGG + Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187637843 X:21251916-21251938 AGGGAGAGAGGAAGAGAGGAAGG - Intergenic
1187654880 X:21460668-21460690 GGGTGGAGGAGAAGTGGGGATGG - Intronic
1187768331 X:22667775-22667797 GGCTGGAGAAGGAGCGAGGTGGG - Intergenic
1188089801 X:25950629-25950651 GGGTAGGGGAGAAGCGAGGAAGG - Intergenic
1188789018 X:34385528-34385550 AGGGGGAGAGGAAGGGAGGGAGG + Intergenic
1188916934 X:35922935-35922957 AGGTGGAGAAGAAGCGAGGAAGG - Intronic
1189192687 X:39124000-39124022 AGGTGGAGAATAAAGGAGTATGG - Intergenic
1189213905 X:39306993-39307015 AGGTTGAGAAGGAGAGAGGGAGG + Intergenic
1189367821 X:40402797-40402819 AGGGGGAGAGGGAGAGAGGAGGG - Intergenic
1189445199 X:41074878-41074900 AGGTGGAGATGCAGAGAGGCAGG + Intergenic
1189899356 X:45689955-45689977 GGGTGCAGAAGAAGACAGGAAGG + Intergenic
1190248811 X:48707366-48707388 AGGGGGAGAAGGAGGGAGGGAGG - Intronic
1190260400 X:48793543-48793565 AGGTGGGGGAGAGGAGAGGAAGG - Intronic
1190393685 X:49957947-49957969 AGGTGGAGAGGGAGAGAGAAAGG + Intronic
1190765151 X:53470062-53470084 AGGTGGGGGAGAAGCTGGGAAGG - Intergenic
1191090783 X:56618400-56618422 AGGAGAGGAAGAAGGGAGGAAGG + Intergenic
1191790854 X:64970479-64970501 AGGAAGAGAGGAAGAGAGGAAGG + Intronic
1191826600 X:65372615-65372637 AGGGAGAGAGGAAGGGAGGAAGG + Intronic
1191938066 X:66446804-66446826 ACGTGGAGTAGAAGAGAGAACGG + Intergenic
1191954788 X:66632462-66632484 AGGAGGAGGAGAAGGGAAGAAGG + Intronic
1192449096 X:71232040-71232062 AGCTGGAGAAACAGCGAAGATGG - Intergenic
1193118149 X:77795455-77795477 AGGTGGGGAAGAGGACAGGAGGG + Intergenic
1194566844 X:95499563-95499585 AAGAGGAGAAGGAGCGAGGGTGG - Intergenic
1194970942 X:100343214-100343236 AGGTGGAGAACCAGGGAAGATGG - Intronic
1195129569 X:101839759-101839781 AGGTGGAGAAGGAGGGAAGGTGG + Intronic
1195176670 X:102320070-102320092 AGGTGGAGAAGGAGGGAAGGTGG - Intronic
1195182194 X:102367023-102367045 AGGTGGAGAAGGAGGGAAGGTGG + Intronic
1195254915 X:103081540-103081562 AGGTGGAGAAGGAGGGAAGGAGG + Intronic
1195698620 X:107685198-107685220 AGGAGGGGAAGAAGTGAGCAAGG - Intergenic
1195870567 X:109481033-109481055 AGGGAGAGAAGAAGGAAGGAAGG + Intronic
1196124223 X:112082351-112082373 AGAGGGAGAAGGAGGGAGGAAGG + Exonic
1196237563 X:113300021-113300043 AGGGGGAGAGGAAGGGAGAAGGG - Intergenic
1196395220 X:115253751-115253773 AGGGGGAAAAGAAACGGGGAAGG + Intergenic
1196845251 X:119892040-119892062 AGGTGGGGGAGAAGCTAAGAAGG - Intergenic
1197430056 X:126351187-126351209 AGGTGGAGAGAAAAGGAGGAGGG + Intergenic
1197629098 X:128837380-128837402 AGGTGGGGAAGAAGAAAGAATGG - Intergenic
1197771200 X:130090592-130090614 AGGTGGGGAGGAAGCAGGGAAGG - Intronic
1198303216 X:135351356-135351378 TGATGGAGAAGAAGGGAGTAAGG + Intronic
1198417364 X:136434245-136434267 ATGTGGAGAAGAGGAAAGGAAGG - Intergenic
1198455433 X:136812880-136812902 AGGAAGAGAGGAAGGGAGGAAGG + Intergenic
1198960994 X:142183009-142183031 ATGTGGGGGAGAAGTGAGGATGG + Intergenic
1199074174 X:143510859-143510881 AGGTGGAGAAGGAAGGGGGATGG - Intronic
1199093168 X:143714120-143714142 AGGTGGAGAAGGAAGGGGGATGG - Intronic
1199149363 X:144411653-144411675 AGGGGGCGATGAAGAGAGGATGG - Intergenic
1199215167 X:145254040-145254062 AGGTGGAGAAGGAAGGGGGATGG + Intronic
1199255622 X:145715706-145715728 TGGTGGAGAAGAGGAGAAGAGGG - Intergenic
1199257993 X:145739048-145739070 AGGTGAAGGAGAAGGCAGGAAGG - Intergenic
1199558736 X:149139299-149139321 AAGTGGAAAAGAAGGAAGGAAGG - Intergenic
1200051157 X:153432562-153432584 AGGGAGAGAAAAAGAGAGGAAGG + Intergenic
1200752376 Y:6958275-6958297 AGGTGGAGAAGAGTTGAGGAAGG - Intronic
1200776978 Y:7178086-7178108 AGGTGGAGGAGAACCAAGGGAGG + Intergenic
1200948715 Y:8870973-8870995 AGGTGGGGGAGAAGCTGGGAAGG - Intergenic
1201349119 Y:13019964-13019986 AGGTGGAGGAGAAGGAGGGAGGG - Intergenic
1201550124 Y:15210478-15210500 AGGAAGAAAAGAAGGGAGGAAGG + Intergenic
1201696168 Y:16828935-16828957 AGGAAGAGAGGAAGGGAGGAAGG + Intergenic
1202349921 Y:23978417-23978439 AAGAGGGGAAGAAGCAAGGAAGG + Intergenic
1202520858 Y:25691704-25691726 AAGAGGGGAAGAAGCAAGGAAGG - Intergenic