ID: 1188922530

View in Genome Browser
Species Human (GRCh38)
Location X:35995112-35995134
Sequence CAGATTAAAAGGATGGAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188922525_1188922530 7 Left 1188922525 X:35995082-35995104 CCTGAAGTTAAGAATAAGTTAAG No data
Right 1188922530 X:35995112-35995134 CAGATTAAAAGGATGGAAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188922530 Original CRISPR CAGATTAAAAGGATGGAAGC GGG Intergenic
No off target data available for this crispr