ID: 1188928352

View in Genome Browser
Species Human (GRCh38)
Location X:36073971-36073993
Sequence TAACTTGCTGCAACCACGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 50}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188928350_1188928352 -2 Left 1188928350 X:36073950-36073972 CCTGCTTTCTCAGCAATGAGGTA 0: 1
1: 0
2: 1
3: 35
4: 329
Right 1188928352 X:36073971-36073993 TAACTTGCTGCAACCACGGCAGG 0: 1
1: 0
2: 0
3: 3
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188928352 Original CRISPR TAACTTGCTGCAACCACGGC AGG Intronic
902650105 1:17831574-17831596 TAACTAATTGCAACCACTGCTGG - Intergenic
903286491 1:22280406-22280428 TAGCTGGCTGCCACCACGCCTGG + Intergenic
903706772 1:25291668-25291690 AAACTTGCTGGACCCACTGCTGG - Intronic
903720462 1:25401673-25401695 AAACTTGCTGGACCCACTGCTGG + Intronic
916914102 1:169387139-169387161 TCAATTGCTGCAATCACTGCCGG + Exonic
919668465 1:200316483-200316505 TAGCCTGCTTCAACCACAGCAGG - Intergenic
923671522 1:236045541-236045563 TGACTGAATGCAACCACGGCAGG + Exonic
1063249729 10:4260928-4260950 TAACTGGCTACAGCCAGGGCCGG + Intergenic
1078407787 11:11086319-11086341 TTAGTTGCTGCAACCCCAGCTGG - Intergenic
1085311988 11:75522357-75522379 AAACTTGCTGCAAAGACGGGGGG - Intronic
1093116812 12:15221560-15221582 TAACGTGCTGCACCCAAGACGGG + Intronic
1093687107 12:22069705-22069727 TAACTTGTAGGAACGACGGCTGG - Intronic
1094388633 12:29923341-29923363 TAAATTGCTGCAGCCACTGTGGG + Intergenic
1100856660 12:98763206-98763228 CAACTTGCTTCACCCACGTCCGG + Intronic
1101741160 12:107501238-107501260 TATCTTGCTGCAACCCTGGATGG + Intronic
1104939062 12:132386423-132386445 TAATTTGCTGCAGCCCCGGGTGG - Intergenic
1202945723 14_KI270726v1_random:24702-24724 TAACTTGATGCACCCACAGATGG - Intergenic
1125501506 15:40242631-40242653 GAACTTGCTGAAGCCAAGGCTGG + Intronic
1125885139 15:43223681-43223703 TAAATTGGTGCAGCCTCGGCTGG + Intergenic
1133161999 16:3918034-3918056 TGACTTCCTGCAACAACGCCTGG - Intergenic
1134684354 16:16148321-16148343 GAACTTGCTGTAACCAAGGGTGG - Intergenic
1142193361 16:88728034-88728056 CAACCTGCAGCAACCACAGCTGG + Intronic
927061628 2:19428167-19428189 CAACTTTCTGGAACTACGGCAGG + Intergenic
928020895 2:27703904-27703926 GAAGTTAATGCAACCACGGCAGG + Intergenic
929011695 2:37451485-37451507 TAACCTGCAGCAACCAGTGCAGG - Intergenic
946179053 2:217939212-217939234 TCACTTGCTGAGACCACAGCTGG + Intronic
1173663424 20:44749853-44749875 TAACTTGCGGCAACCAAGGATGG - Intronic
1178706552 21:34878575-34878597 AAAATAGCTGCAACCAAGGCTGG - Intronic
1182749059 22:32627161-32627183 TAACTTCCTGCAACAGCGGCAGG + Intronic
1185157234 22:49201328-49201350 TAACCTGCTGCCACCATGCCTGG + Intergenic
953849565 3:46455479-46455501 TAACCTGCTGTGACCAGGGCTGG - Intronic
979855642 4:125630188-125630210 TGACTAGCAGCAACCACTGCCGG - Intergenic
981526426 4:145710701-145710723 TAATTGGCTGCAACCAATGCCGG - Intronic
982132921 4:152246745-152246767 TGCCTTGCTGAAAGCACGGCTGG + Intergenic
986457157 5:7931216-7931238 TTACTTGCTGCATCCAAGCCAGG + Intergenic
997450297 5:133977170-133977192 CAACCTGCTGCAGCCACTGCTGG + Intronic
1000572732 5:162935493-162935515 CAACCTGCTGCTACCACAGCTGG - Intergenic
1011985922 6:93445864-93445886 TAACTTGTTGCTACCAGGGATGG + Intergenic
1013430481 6:110050946-110050968 TACCTTGCTGCAAGGAAGGCTGG - Intergenic
1021006926 7:15408722-15408744 TAACTAGCTGCAACAACAGTAGG + Intronic
1024410215 7:49031838-49031860 TAATTTGCTACAACCACCCCAGG + Intergenic
1025212796 7:57030465-57030487 TAAGTCGGTCCAACCACGGCAGG + Intergenic
1025659157 7:63546359-63546381 TAAGTCGGTCCAACCACGGCAGG - Intergenic
1035721471 8:1796528-1796550 TAACTTCCTCCATCCAAGGCTGG + Intergenic
1053573966 9:39338981-39339003 TAAGATGCTCCAACCATGGCTGG + Intergenic
1053838529 9:42167219-42167241 TAAGATGCTCCAACCATGGCTGG + Intergenic
1054095531 9:60897669-60897691 TAAGATGCTCCAACCATGGCTGG + Intergenic
1054116993 9:61173607-61173629 TAAGATGCTCCAACCATGGCTGG + Intergenic
1054590760 9:67008961-67008983 TAAGATGCTCCAACCATGGCTGG - Intergenic
1059208785 9:112491413-112491435 TAACTTGCAGCAACCAAGGGGGG - Intronic
1188530984 X:31140892-31140914 TAACTGGCTGAAAACATGGCTGG + Intronic
1188557715 X:31430766-31430788 TAACTTGCTTCAAACAAGTCAGG - Intronic
1188928352 X:36073971-36073993 TAACTTGCTGCAACCACGGCAGG + Intronic
1189674648 X:43449175-43449197 TAACTTGCAGCAACCAGCCCAGG - Intergenic