ID: 1188932281

View in Genome Browser
Species Human (GRCh38)
Location X:36126285-36126307
Sequence AGAACACGTTGACATAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29248
Summary {0: 2, 1: 13, 2: 550, 3: 6955, 4: 21728}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188932281_1188932287 21 Left 1188932281 X:36126285-36126307 CCCTCCCTATGTCAACGTGTTCT 0: 2
1: 13
2: 550
3: 6955
4: 21728
Right 1188932287 X:36126329-36126351 GTGTGAGAACATGCAGTGTTTGG 0: 25
1: 4539
2: 11585
3: 18008
4: 10905

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188932281 Original CRISPR AGAACACGTTGACATAGGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr