ID: 1188932282

View in Genome Browser
Species Human (GRCh38)
Location X:36126286-36126308
Sequence GAGAACACGTTGACATAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29861
Summary {0: 2, 1: 15, 2: 611, 3: 8475, 4: 20758}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188932282_1188932287 20 Left 1188932282 X:36126286-36126308 CCTCCCTATGTCAACGTGTTCTC 0: 2
1: 15
2: 611
3: 8475
4: 20758
Right 1188932287 X:36126329-36126351 GTGTGAGAACATGCAGTGTTTGG 0: 25
1: 4539
2: 11585
3: 18008
4: 10905

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188932282 Original CRISPR GAGAACACGTTGACATAGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr