ID: 1188932283

View in Genome Browser
Species Human (GRCh38)
Location X:36126289-36126311
Sequence AGTGAGAACACGTTGACATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 10706
Summary {0: 1, 1: 3, 2: 66, 3: 1192, 4: 9444}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188932283_1188932287 17 Left 1188932283 X:36126289-36126311 CCCTATGTCAACGTGTTCTCACT 0: 1
1: 3
2: 66
3: 1192
4: 9444
Right 1188932287 X:36126329-36126351 GTGTGAGAACATGCAGTGTTTGG 0: 25
1: 4539
2: 11585
3: 18008
4: 10905

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188932283 Original CRISPR AGTGAGAACACGTTGACATA GGG (reversed) Intronic
Too many off-targets to display for this crispr