ID: 1188932287

View in Genome Browser
Species Human (GRCh38)
Location X:36126329-36126351
Sequence GTGTGAGAACATGCAGTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45062
Summary {0: 25, 1: 4539, 2: 11585, 3: 18008, 4: 10905}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188932284_1188932287 16 Left 1188932284 X:36126290-36126312 CCTATGTCAACGTGTTCTCACTG 0: 1
1: 3
2: 97
3: 2244
4: 22398
Right 1188932287 X:36126329-36126351 GTGTGAGAACATGCAGTGTTTGG 0: 25
1: 4539
2: 11585
3: 18008
4: 10905
1188932281_1188932287 21 Left 1188932281 X:36126285-36126307 CCCTCCCTATGTCAACGTGTTCT 0: 2
1: 13
2: 550
3: 6955
4: 21728
Right 1188932287 X:36126329-36126351 GTGTGAGAACATGCAGTGTTTGG 0: 25
1: 4539
2: 11585
3: 18008
4: 10905
1188932283_1188932287 17 Left 1188932283 X:36126289-36126311 CCCTATGTCAACGTGTTCTCACT 0: 1
1: 3
2: 66
3: 1192
4: 9444
Right 1188932287 X:36126329-36126351 GTGTGAGAACATGCAGTGTTTGG 0: 25
1: 4539
2: 11585
3: 18008
4: 10905
1188932282_1188932287 20 Left 1188932282 X:36126286-36126308 CCTCCCTATGTCAACGTGTTCTC 0: 2
1: 15
2: 611
3: 8475
4: 20758
Right 1188932287 X:36126329-36126351 GTGTGAGAACATGCAGTGTTTGG 0: 25
1: 4539
2: 11585
3: 18008
4: 10905

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188932287 Original CRISPR GTGTGAGAACATGCAGTGTT TGG Intronic
Too many off-targets to display for this crispr