ID: 1188935211

View in Genome Browser
Species Human (GRCh38)
Location X:36167368-36167390
Sequence TTCAGCAAACCCTCCATTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188935206_1188935211 21 Left 1188935206 X:36167324-36167346 CCATGACTCTAGAGCTAGGGGTG No data
Right 1188935211 X:36167368-36167390 TTCAGCAAACCCTCCATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188935211 Original CRISPR TTCAGCAAACCCTCCATTTT AGG Intergenic
No off target data available for this crispr