ID: 1188942569

View in Genome Browser
Species Human (GRCh38)
Location X:36258776-36258798
Sequence CATTTCCGTGGATAAAGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 216}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188942569_1188942573 23 Left 1188942569 X:36258776-36258798 CCATTTCTTTATCCACGGAAATG 0: 1
1: 0
2: 1
3: 27
4: 216
Right 1188942573 X:36258822-36258844 CCTGTTGCTGTGTCATCAATGGG 0: 1
1: 0
2: 0
3: 20
4: 428
1188942569_1188942571 22 Left 1188942569 X:36258776-36258798 CCATTTCTTTATCCACGGAAATG 0: 1
1: 0
2: 1
3: 27
4: 216
Right 1188942571 X:36258821-36258843 ACCTGTTGCTGTGTCATCAATGG 0: 1
1: 0
2: 2
3: 15
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188942569 Original CRISPR CATTTCCGTGGATAAAGAAA TGG (reversed) Intronic
901894907 1:12303151-12303173 CATTCCAGTGGTTAAAGAACAGG + Intronic
903618194 1:24677773-24677795 CATTTCCATTGAAGAAGAAATGG - Intergenic
912616552 1:111106692-111106714 CATGTCCGTGAATAATGTAATGG - Intergenic
915282861 1:154834476-154834498 CATGTTCTTGGAGAAAGAAATGG - Intronic
916575399 1:166062594-166062616 CATGTGCGTGTACAAAGAAATGG + Intronic
918783393 1:188732041-188732063 ACTTTCCTTGGAAAAAGAAATGG - Intergenic
919186887 1:194162486-194162508 CATGTCCGTGGTTAAATATATGG - Intergenic
921460909 1:215425692-215425714 CATTTCTATAGATAAACAAATGG - Intergenic
921923509 1:220692842-220692864 GATTTCAGTGGATAGAGAAGTGG + Intronic
922007537 1:221547292-221547314 CACTTCCGTGGATAGAGATAGGG - Intergenic
923091059 1:230741633-230741655 CAAGTCCCTGGATGAAGAAAGGG + Intergenic
923745855 1:236699634-236699656 CATTCCTGTAGATAAAGACACGG - Intronic
1063938376 10:11102751-11102773 GACTTCCATGGAGAAAGAAAGGG - Intronic
1064723567 10:18254667-18254689 CATTTTGGTGGCTAAAGAAGTGG + Intronic
1065789100 10:29243421-29243443 CCTTTCCCTGGAGAAAGAAGAGG + Intergenic
1066701334 10:38132332-38132354 CGTTTCAGTTGATACAGAAAAGG - Intergenic
1067986327 10:51150307-51150329 CATTTCTTTGGGGAAAGAAAGGG + Intronic
1068449610 10:57168977-57168999 CATTTCAATAGATACAGAAAAGG + Intergenic
1068662030 10:59632705-59632727 CATTTCTGGGGACAAAGAATAGG - Intergenic
1069936331 10:71919853-71919875 CATTTACCTGGATAAAGGATGGG - Intergenic
1071346132 10:84695662-84695684 AATTTCTATGGATACAGAAAAGG - Intergenic
1073671461 10:105594971-105594993 CTTTTCATTGTATAAAGAAAAGG - Intergenic
1073855278 10:107666343-107666365 AATTTCCCTAGAGAAAGAAATGG + Intergenic
1075837586 10:125468498-125468520 CCTATCAGTGGATTAAGAAAAGG - Intergenic
1075955164 10:126517344-126517366 AATTGCCCTGGTTAAAGAAACGG + Intronic
1078645226 11:13135908-13135930 CATTTCCCTGCATAAACACAGGG + Intergenic
1080109827 11:28554148-28554170 CATTTCTGTGGGCAAAGAAATGG + Intergenic
1081129001 11:39353573-39353595 CATTTCAGTGGAGGAAGAAGAGG + Intergenic
1082952891 11:58836885-58836907 CAATTGCATGGGTAAAGAAAGGG - Intronic
1083506800 11:63165499-63165521 CATTTCTGTACATAAAGATACGG + Intronic
1085856026 11:80177121-80177143 CATCTCAGTAGATGAAGAAAAGG - Intergenic
1086306981 11:85491179-85491201 CATTTCAATAGATATAGAAAAGG + Intronic
1086500320 11:87446269-87446291 CATTACTGTAGATAAAGGAATGG + Intergenic
1087054118 11:93916777-93916799 CATCTCAGTGGATAGAGAAAAGG - Intergenic
1087734614 11:101817877-101817899 CATTTCCCTGGAAAAATAATAGG - Intronic
1088044190 11:105427744-105427766 CATTTCACTGGATTAAGAATTGG - Intergenic
1088568925 11:111202445-111202467 CATTTCAGGAGAGAAAGAAAAGG - Intergenic
1089100365 11:115957986-115958008 CATTTCCAAAGACAAAGAAATGG - Intergenic
1091141305 11:133237333-133237355 CTTTTCTGTGGACAAAGCAAGGG + Intronic
1091609444 12:1992047-1992069 CATTTCTGTAGAGAAGGAAAGGG + Intronic
1091609529 12:1993270-1993292 CATTTCTGTAGAGAAGGAAAGGG + Exonic
1093855341 12:24094961-24094983 GATTTCCTTGGATAAACAAAAGG - Intergenic
1094290653 12:28845059-28845081 CAATTCAATGGATGAAGAAAGGG - Intergenic
1094558313 12:31524910-31524932 CATTTTAGTAGATGAAGAAAGGG - Intronic
1095618311 12:44219061-44219083 CATTTGCAAGGAGAAAGAAAGGG - Intronic
1097535626 12:60866759-60866781 TATTTTCTTGAATAAAGAAATGG - Intergenic
1098760285 12:74415961-74415983 CATTTCAATGGATAAACAAAAGG + Intergenic
1099675051 12:85748444-85748466 CATTTTCGTAGATGAGGAAATGG - Intergenic
1100323568 12:93519782-93519804 CATTTGCCTGGATAAACACAAGG - Intergenic
1100759880 12:97795704-97795726 CTTTTCAGTGGAGAAAAAAAAGG + Intergenic
1100769638 12:97907662-97907684 CACTTCAGTGGATGAAAAAAAGG + Intergenic
1102542151 12:113628942-113628964 CATATCCCTGGACAAAGAGAAGG - Intergenic
1103592315 12:122000886-122000908 CATTTTTGTGTCTAAAGAAAAGG + Intronic
1104099655 12:125594991-125595013 CATTCCCATGGACAAACAAAAGG + Intronic
1104374187 12:128249548-128249570 CCTTTCCACGGAGAAAGAAATGG - Intergenic
1105296125 13:19089300-19089322 CATCTTCCTGGATAAAGACAAGG + Intergenic
1106148266 13:27071820-27071842 CATATCCTTTTATAAAGAAAAGG - Intronic
1108560324 13:51636828-51636850 CAACTCCGTGGAGAAAGAACAGG + Intronic
1108645967 13:52428517-52428539 AATTTCCTTAGATAAACAAAAGG + Intronic
1109084793 13:57956226-57956248 CATATGGATGGATAAAGAAAAGG - Intergenic
1109317422 13:60766770-60766792 CTTTTCCATGGATGAAGAAGAGG + Intergenic
1109436012 13:62303706-62303728 TATTTCAGTAGATGAAGAAAAGG - Intergenic
1111045160 13:82805263-82805285 CAGTTCCGTGGAAAAAGCATAGG - Intergenic
1111866480 13:93774947-93774969 CATCTCAGTGGAGAAACAAAGGG + Intronic
1114377682 14:22166007-22166029 CATTTACGTGCATTACGAAAAGG - Intergenic
1115871919 14:37814238-37814260 CATTTCCAAGGAATAAGAAAAGG - Intronic
1116430955 14:44844735-44844757 CATTTTCAATGATAAAGAAAGGG + Intergenic
1116698574 14:48207113-48207135 CATTACCTTGGATAGAGAATAGG - Intergenic
1117214842 14:53540071-53540093 CATTTCTGAGGTTAAACAAAGGG - Intergenic
1117901784 14:60541923-60541945 CATTTCTTTGGATAGAGAAGTGG - Intergenic
1120871445 14:89340683-89340705 CAATTCAGTGGATAAACAATAGG + Intronic
1122806371 14:104261818-104261840 CAGTTGAGTGGATAAATAAAAGG + Intergenic
1123134974 14:106019213-106019235 CATTTCCTGGAGTAAAGAAAGGG + Intergenic
1123585518 15:21757083-21757105 CATTTCCTGGAGTAAAGAAAGGG + Intergenic
1123622159 15:22199671-22199693 CATTTCCTGGAGTAAAGAAAGGG + Intergenic
1125120317 15:36150013-36150035 CATCTCAGTTGATGAAGAAAAGG + Intergenic
1127111720 15:55680340-55680362 CATTTCAGTGAGTAGAGAAAAGG - Intronic
1129519186 15:76175432-76175454 CATTTCTGTGGATCTAGAAGGGG - Intronic
1131132883 15:89911470-89911492 CATTTCTGTGGATGCAAAAAAGG - Intronic
1135064298 16:19296309-19296331 CATTTCTCTGGGGAAAGAAAGGG - Intronic
1135739886 16:24965885-24965907 CTTTTCCCTGGAGAAAAAAATGG - Intronic
1137449724 16:48560290-48560312 TATTTCTGTGGATAGAGCAATGG - Intronic
1139158582 16:64475301-64475323 CTTCTCCCTGGATCAAGAAATGG - Intergenic
1139173038 16:64653749-64653771 TATTTCAATGGATACAGAAAAGG + Intergenic
1139258801 16:65571875-65571897 AATTTCCGTGGAAGAAGAAAAGG - Intergenic
1139908671 16:70383189-70383211 CCTTCGAGTGGATAAAGAAAAGG - Exonic
1141220818 16:82067966-82067988 CATTTCCCCATATAAAGAAAGGG - Intronic
1142042200 16:87901511-87901533 CATTTGCAAGGAAAAAGAAATGG - Intronic
1148440588 17:47709669-47709691 CATTTCCTTGGATAAGGATATGG + Intronic
1149006103 17:51807156-51807178 CATTTCCCTGTAGAAAGCAATGG + Intronic
1149130230 17:53291591-53291613 CACTTGCGTGGAGATAGAAAAGG - Intergenic
1149383306 17:56116349-56116371 CAATCCAGTGGATAAACAAAAGG + Intronic
1149568635 17:57656695-57656717 CAGTTTCGTGGAGACAGAAAGGG + Intronic
1150861943 17:68809631-68809653 CAGTTCAGTGGATGAAGAAGAGG + Intergenic
1152354613 17:79800812-79800834 CATTTCCGTAAACAAAGAAACGG - Intronic
1153487837 18:5618520-5618542 GATTTCAGTGGAAAAACAAAAGG + Intronic
1155638932 18:27989403-27989425 GATTTCAGTGAATAGAGAAATGG + Intronic
1156774137 18:40766352-40766374 AATTTCCATGGAAAAACAAATGG - Intergenic
1156815204 18:41301916-41301938 CATATCAATAGATAAAGAAAAGG - Intergenic
1159648191 18:70943939-70943961 CATTTATTTGGAAAAAGAAAGGG + Intergenic
1162962371 19:14135909-14135931 GATCTCCGTGGGTTAAGAAATGG + Intronic
1164408777 19:27979093-27979115 CAGATGAGTGGATAAAGAAAAGG + Intergenic
930831208 2:55745194-55745216 ATTTTCCCTGGAGAAAGAAAAGG - Intergenic
930901990 2:56518584-56518606 CATTTCAGTGGAGATGGAAAAGG - Intergenic
933312092 2:80673508-80673530 CAGTTCTGTGGCTAAAGAACAGG - Intergenic
935253699 2:101289049-101289071 CAATTCCCTGTAAAAAGAAAAGG + Exonic
935378362 2:102423160-102423182 CATTTCTGTAAATCAAGAAATGG - Exonic
937154931 2:119712173-119712195 CATTTTTATAGATAAAGAAACGG - Intergenic
939660069 2:144878465-144878487 CATTTGTGTGGATAAAGAGAAGG - Intergenic
940269142 2:151872488-151872510 GATTTCCTAGGATATAGAAAAGG + Exonic
940544714 2:155069377-155069399 CACTTCCTTGGAAGAAGAAATGG - Intergenic
940865786 2:158816745-158816767 CCTTTCCCTGGGTAAAGAGAAGG - Intronic
946128053 2:217581667-217581689 CTCTTCCATGGATAAGGAAAGGG + Intronic
1169526244 20:6429014-6429036 CATTTCCATGGACACAGGAAGGG - Intergenic
1170853673 20:20027905-20027927 AATTACAGTGGAGAAAGAAATGG - Intronic
1171568177 20:26215429-26215451 CATTTCCAAAGATTAAGAAAGGG + Intergenic
1173249103 20:41355318-41355340 CATTTCTCAGGAGAAAGAAAAGG - Intronic
1173556012 20:43966405-43966427 GATTTCGGTGGATAGAGAAAGGG + Intronic
1173720802 20:45256146-45256168 AATTTTGGTGGAAAAAGAAAAGG + Intergenic
1174147788 20:48464203-48464225 CATGTCTGTGGATAAAGAGCAGG + Intergenic
1177576844 21:22968267-22968289 AATTTCCTTGGACAAAGAAATGG + Intergenic
1178749695 21:35289501-35289523 CATTTCTGTGGCTAAATAATTGG + Intronic
1182086901 22:27567205-27567227 CATTTCCTTGTATACAGATAAGG + Intergenic
1182854533 22:33505464-33505486 CGTTTCCCTGGAAGAAGAAAAGG + Intronic
1183950864 22:41352140-41352162 CATCTCCCTTGATGAAGAAACGG + Intronic
949650294 3:6150414-6150436 CATTTTTGTGGAAAGAGAAAGGG - Intergenic
950502896 3:13375792-13375814 CATCCCCGTGGAGAAAGAGAGGG - Intronic
951646271 3:24894976-24894998 CATCTCCCTGGCTAAAGCAAAGG - Intergenic
951913336 3:27773960-27773982 CATTTCAGTGGATACAAAGATGG + Intergenic
957369812 3:79278979-79279001 CATTTCAGCAGATAAAAAAATGG + Intronic
957971141 3:87384143-87384165 TATTTCAGTAGATACAGAAAAGG - Intergenic
958689516 3:97445397-97445419 CATTTTTGTGGATTAAGACATGG - Intronic
960648691 3:119921193-119921215 AATTTTCGTAAATAAAGAAAAGG + Intronic
962359527 3:134726214-134726236 CCTTTCCGTGGAAAAAGCCAGGG - Intronic
965312165 3:167142236-167142258 CAATTCAGTGGAGAAAGAAGAGG + Intergenic
965338918 3:167461980-167462002 CATTTCCCAGTATAAAGAGAAGG - Intronic
965629637 3:170718881-170718903 CATTTTCCTGGAAAAAAAAAGGG - Intronic
967190251 3:186978573-186978595 CATTTCCGTGAATAAAGGAAAGG - Intronic
968708404 4:2094893-2094915 CCTTTCTGTGAATAAACAAAGGG + Intronic
970501215 4:16679249-16679271 GATGTCAGTGTATAAAGAAAGGG + Intronic
971644275 4:29177825-29177847 CATTTCAGTTTTTAAAGAAAGGG - Intergenic
975182602 4:71363973-71363995 CATCTGCCTGGAGAAAGAAAAGG - Intronic
975491928 4:74998768-74998790 TCTTTCCCTGAATAAAGAAAGGG - Intronic
975695426 4:77008185-77008207 CTCTTCAGTGGAGAAAGAAAGGG + Intronic
977447900 4:97154782-97154804 TCTTTCTGTAGATAAAGAAAGGG - Intergenic
977919457 4:102626983-102627005 CATCCTCGTGGATAAAGACATGG - Intergenic
978289177 4:107117146-107117168 AATTTCAGTTGAAAAAGAAAAGG + Intronic
979719223 4:123879470-123879492 CATATATATGGATAAAGAAAAGG + Intergenic
981847146 4:149182426-149182448 CTTTACCGTCGATAAAGATATGG - Intergenic
983026952 4:162749882-162749904 CATTTCCTGGGATAACAAAATGG - Intergenic
983046384 4:162991483-162991505 CATTTCCCTGGAGAAAGATAGGG + Intergenic
983132913 4:164043778-164043800 CATATGCATGGAGAAAGAAATGG - Intronic
988690363 5:33565859-33565881 AATTTGCGTGGATATAGTAATGG + Intronic
988771448 5:34437183-34437205 CATTTCCGAGGATAAGGACTTGG - Intergenic
988863375 5:35307959-35307981 CATTGCAGTGGATTAAGAAAAGG + Intergenic
989003554 5:36785349-36785371 CTTTTCCATCAATAAAGAAAAGG + Intergenic
989244500 5:39239069-39239091 CATTTCAATGGATGCAGAAAAGG + Intronic
989347113 5:40441433-40441455 CATTTCGGTGGCTAACGAAAGGG + Intergenic
993648357 5:90486961-90486983 GATTTCAGAGGATAAAGATAAGG - Intronic
994131528 5:96234642-96234664 CATTTCTATGCAGAAAGAAAAGG + Intergenic
995117403 5:108496825-108496847 CATTTCCATGGATGCAGAACTGG + Intergenic
997066049 5:130560253-130560275 CATTTCAGTAGATGCAGAAAAGG + Intergenic
999515378 5:152296945-152296967 CATTTTAGGGGCTAAAGAAAGGG + Intergenic
1000385237 5:160669116-160669138 CTTTTCCCTGGTTAAAGAAAGGG + Intronic
1001299955 5:170526330-170526352 CATTTCTGTAGATGAAGAAAGGG + Intronic
1003550807 6:7100723-7100745 CAATTCAGTGGAAAAAGAAGAGG - Intergenic
1003733365 6:8850823-8850845 TATTTCCCTTGACAAAGAAAAGG - Intergenic
1003869547 6:10390934-10390956 CCTTCCCGTGGAAAAAAAAAAGG + Intergenic
1005801917 6:29434730-29434752 CAGTCCCATGGATAAAGACAAGG + Intronic
1007060732 6:38938354-38938376 CAGTAGAGTGGATAAAGAAAAGG + Intronic
1007511173 6:42375388-42375410 CATTTGTGTGGATAAAGAAGAGG - Intronic
1008247566 6:49196706-49196728 CTTTTCCATGGATGAATAAAAGG + Intergenic
1008438751 6:51507844-51507866 CAGTTAATTGGATAAAGAAATGG + Intergenic
1010811051 6:80299235-80299257 CATTTGCCTGGGTAAAGAATGGG - Intronic
1012181436 6:96158166-96158188 CATTTTTGTAGATAAATAAAGGG + Intronic
1012820865 6:104083421-104083443 ACTTTGCGTGGAAAAAGAAATGG + Intergenic
1014292516 6:119575541-119575563 CTTTTCCGCGGAGAAAGAATTGG + Intergenic
1014590323 6:123258368-123258390 TATTTCAATAGATAAAGAAAAGG - Intronic
1015929590 6:138344822-138344844 CATTTCCTTGTTTAAAAAAAGGG + Intergenic
1017848377 6:158280104-158280126 CATTCACGTTGATAAATAAAAGG - Intronic
1018244600 6:161810594-161810616 CATTCCCTTGGATCAAGACATGG + Intronic
1019727639 7:2611836-2611858 CAGTTCAGTGGAAAAAAAAATGG - Exonic
1021134246 7:16946181-16946203 CATTTTTATGGATAAAGAAATGG - Intergenic
1022378040 7:29833425-29833447 CATTTTTATAGATAAAGAAAAGG - Intronic
1022742639 7:33137559-33137581 AATTTCCTTTGATAAAAAAATGG - Intronic
1023273495 7:38492744-38492766 CATTTCCTTTAAAAAAGAAATGG + Intronic
1023526835 7:41113151-41113173 CATTTCTCCAGATAAAGAAATGG - Intergenic
1024064752 7:45723126-45723148 CATTTCAGTTGAAAAATAAATGG + Intergenic
1025550179 7:62236595-62236617 AATATCCCTGGATAAAAAAAAGG + Intergenic
1027771855 7:82416967-82416989 CCTTTACGTGCATTAAGAAATGG - Intronic
1027854372 7:83490072-83490094 CATTTCAGTAGAGATAGAAAAGG - Intronic
1029982233 7:104889789-104889811 AATTTCAGTGGATAAATTAATGG + Intronic
1031059509 7:117034529-117034551 CATTTTCATGAATAAAGAAAAGG - Intronic
1031451051 7:121919526-121919548 CATTTCTATGTATGAAGAAAAGG - Intronic
1031639306 7:124142124-124142146 CATTTCAGTGAATGAAGAAATGG - Intergenic
1031806526 7:126314585-126314607 CATATGCGTGGATGAATAAAAGG - Intergenic
1033970412 7:147032572-147032594 CATTTCAGTATAGAAAGAAAAGG - Intronic
1034109487 7:148522420-148522442 CATTTCTGTAGGTAAACAAAAGG - Intergenic
1034302192 7:150026054-150026076 TTATTCCGGGGATAAAGAAAGGG + Intergenic
1036293327 8:7515044-7515066 CATTTCCTTGGACAAAGGTAGGG - Intergenic
1036329231 8:7805953-7805975 CATTTCCTTGGACAAAGGTAGGG + Intergenic
1036522437 8:9504408-9504430 CATTTTCATAGATAAAGATATGG + Intergenic
1038703075 8:29869081-29869103 CATTTCTATGGATAATGAATGGG - Intergenic
1038782418 8:30579655-30579677 CATGACGGTGGATAAGGAAAGGG + Intronic
1038960962 8:32519446-32519468 CATTACCTTGGAGAAGGAAATGG + Intronic
1039670556 8:39592453-39592475 CAGTTCACTGGATAAATAAAAGG + Intronic
1039768293 8:40654713-40654735 CATCTCAATGGATAAAGAAAAGG + Intronic
1041171076 8:55142269-55142291 CATTCTCCTGGATAAGGAAAGGG + Exonic
1041356361 8:57005017-57005039 CATTTCCTTAGAAGAAGAAAAGG - Intergenic
1045602316 8:103732276-103732298 CATTTCTTTGGAGAAAGGAAGGG - Intronic
1045623251 8:104007949-104007971 TTTTTACGTGGATAGAGAAATGG - Intronic
1046039454 8:108884673-108884695 CATTTCAGAGAAGAAAGAAAGGG - Intergenic
1046804069 8:118460940-118460962 CATTTTGGTGGCTAGAGAAATGG - Intronic
1046956574 8:120068640-120068662 AATTTCTGTGGATAAAGAGATGG + Intronic
1047171951 8:122502376-122502398 TATTTTCCTGGAGAAAGAAAGGG + Intergenic
1049535546 8:143179062-143179084 ACTTTCCGTGCATAAACAAAAGG + Intergenic
1052138264 9:24942978-24943000 ACTTTCCATGCATAAAGAAAAGG - Intergenic
1054898795 9:70344917-70344939 TATTTCAGTAGATAATGAAATGG + Intronic
1056686150 9:88762106-88762128 CATATCAGTTGATACAGAAAAGG + Intergenic
1057223432 9:93270410-93270432 CATTTCAGTGGAAAGAAAAATGG - Intronic
1058060080 9:100486072-100486094 CTTTTCCATGGATTAAAAAAGGG + Intronic
1058583999 9:106487126-106487148 AAGTCCCCTGGATAAAGAAAAGG - Intergenic
1061803375 9:133125034-133125056 CATTTCAGAGGAAAAAGAAAGGG + Intronic
1185509180 X:650146-650168 CAGCGCCGTGGATAAAGAGATGG + Intronic
1187237886 X:17485417-17485439 CAGCTCTGGGGATAAAGAAAGGG - Intronic
1187666965 X:21624426-21624448 AATTCCTGTGGATAAAGAATGGG + Intronic
1188013680 X:25084602-25084624 CCATTATGTGGATAAAGAAATGG + Intergenic
1188074530 X:25758911-25758933 CATTTACTTAGATAAAGAGATGG + Intergenic
1188135850 X:26494016-26494038 CATTTGCTTGGATCAAGAGATGG - Intergenic
1188268993 X:28115082-28115104 TATTTCAGGGCATAAAGAAAAGG + Intergenic
1188644700 X:32551395-32551417 CATTTCAGTAGATATAGAAAAGG + Intronic
1188942569 X:36258776-36258798 CATTTCCGTGGATAAAGAAATGG - Intronic
1191730203 X:64325549-64325571 CATTTCAATAGATGAAGAAAAGG + Intronic
1191847436 X:65558100-65558122 CATTTGTGTGAATAAAAAAAAGG - Intergenic
1193672825 X:84410384-84410406 CATTTCAATAGATGAAGAAAAGG - Intronic
1193899064 X:87153005-87153027 TATTTCAGTGGATACAGAAAAGG - Intergenic
1194384990 X:93241740-93241762 CATTTCAATAGATACAGAAAAGG + Intergenic
1194760994 X:97795729-97795751 CAGTTCTGTAGATAAAGAAAAGG - Intergenic
1194948394 X:100095475-100095497 TATTTCCATAGATACAGAAAAGG + Intergenic
1195548759 X:106142520-106142542 TATTTCAATGGATATAGAAAAGG + Intergenic
1197186935 X:123598108-123598130 CTTTTCAGTGGATAAAACAAAGG - Intergenic
1197431574 X:126373230-126373252 CAGTTCATTGGATAAAGAAAAGG - Intergenic
1198888833 X:141369558-141369580 TATCTCCGTAGATACAGAAAAGG + Intergenic
1201851439 Y:18486664-18486686 CTTTCACGTGGAAAAAGAAAAGG + Intergenic
1201881880 Y:18833715-18833737 CTTTCACGTGGAAAAAGAAAAGG - Intergenic