ID: 1188944738

View in Genome Browser
Species Human (GRCh38)
Location X:36285492-36285514
Sequence TTGTCAAGACAGCTGAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188944738_1188944739 -2 Left 1188944738 X:36285492-36285514 CCTTTCTTCAGCTGTCTTGACAA 0: 1
1: 0
2: 1
3: 24
4: 209
Right 1188944739 X:36285513-36285535 AAAAAGTCCATTAAACAAAAAGG 0: 1
1: 0
2: 12
3: 94
4: 855

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188944738 Original CRISPR TTGTCAAGACAGCTGAAGAA AGG (reversed) Intronic
900734276 1:4285727-4285749 TTGTCAAGCCAGCTTGACAAGGG + Intergenic
901203342 1:7479265-7479287 TTGCCTAGACAGGTGAAGACAGG + Intronic
901484250 1:9547479-9547501 TTGTTAAGACAGAGGAAGAGAGG + Intronic
901711227 1:11117035-11117057 TTGACATGACCGCTAAAGAACGG + Exonic
908319925 1:62969116-62969138 TGGGGAAGAAAGCTGAAGAAAGG + Intergenic
913083543 1:115412856-115412878 CTGGGAAGGCAGCTGAAGAATGG + Intergenic
914325276 1:146608319-146608341 TTGTCAGAACAGCTGAAGGTCGG + Intergenic
914827009 1:151144017-151144039 GCCTCAAGAGAGCTGAAGAAAGG + Intronic
916117800 1:161502522-161502544 ATGTCAAGCCAGCTCAAGAAGGG - Intergenic
916965704 1:169940257-169940279 TCTTCACAACAGCTGAAGAAGGG - Intronic
918951089 1:191138804-191138826 TTTTCATGACATCTGAAGACGGG + Intergenic
919954289 1:202397257-202397279 CAGTCAAGTAAGCTGAAGAAAGG - Intronic
920188037 1:204174377-204174399 TTTTGCAGACAGGTGAAGAAGGG + Intergenic
920816713 1:209341247-209341269 TCCTCAAGCCAGCTGAAGGATGG + Intergenic
920890618 1:209981768-209981790 TTTTCAAGAAAGCTGAAAATAGG + Intronic
922151703 1:223011104-223011126 TTGTAAAGAGATCTGAGGAAAGG + Intergenic
923230845 1:231984800-231984822 TGGCCAAGACAGCTGAGGAAAGG + Intronic
923668554 1:236020103-236020125 TTTTCAATACCACTGAAGAAAGG - Intronic
924085267 1:240444854-240444876 TTGAAAATACATCTGAAGAATGG + Intronic
924362491 1:243255765-243255787 TGGTCCAGGCAGCTGAAGAGTGG + Intergenic
924558913 1:245141564-245141586 TTGCCAACACACCTGCAGAAGGG - Intergenic
1069252911 10:66293959-66293981 TTGTCAAGAATGCTGATGACCGG - Intronic
1069984103 10:72272429-72272451 TCTTAAAGACAGCTGCAGAATGG - Intergenic
1073037901 10:100576965-100576987 CTGTCCAGGGAGCTGAAGAAGGG - Intergenic
1073633062 10:105168002-105168024 TTTTCATGAATGCTGAAGAAAGG + Intronic
1074915383 10:117950431-117950453 TTTCAAAGACAGCTGAAGGAAGG - Intergenic
1076633090 10:131864222-131864244 TAATCAAGACAGCTGAATACTGG + Intergenic
1077203284 11:1325203-1325225 TTGTCAAGATAATTAAAGAAGGG + Intergenic
1078028413 11:7722309-7722331 TGGTGATGAGAGCTGAAGAAGGG + Intergenic
1078716995 11:13849612-13849634 TTTTCAAGCCAGCCAAAGAAGGG - Intergenic
1079013710 11:16850900-16850922 GTGATAAGACAGCTCAAGAAGGG + Intronic
1079882845 11:25947786-25947808 TTCTCAAGCCACCAGAAGAAAGG + Intergenic
1080202190 11:29685043-29685065 TTGTAAAGACATGTAAAGAAAGG + Intergenic
1080498659 11:32847245-32847267 TTTTAAAGATAGCTCAAGAAAGG + Intronic
1081048669 11:38310195-38310217 TTGTATAGACAGCTGAATAATGG + Intergenic
1083688287 11:64390905-64390927 TTGTCACCGCACCTGAAGAATGG - Intergenic
1085935371 11:81135381-81135403 TTGTCATGTCAGGGGAAGAAAGG + Intergenic
1087025040 11:93641463-93641485 TTGACAAGAAAGCTGGAGAAAGG + Intergenic
1088428984 11:109736598-109736620 CTGTGAAGAGAGATGAAGAATGG + Intergenic
1088947719 11:114531645-114531667 TTGTCAAGACATCAAAAGCAAGG - Intronic
1091463367 12:662860-662882 TTGTGAAGACAGCCGAGAAACGG + Intronic
1092990216 12:13890166-13890188 GTTTCAACACAGATGAAGAATGG + Intronic
1093190080 12:16064352-16064374 TTGTTGAGAGAGCCGAAGAAGGG + Intergenic
1095759263 12:45809975-45809997 TTTTTAAGACAGCTGAGGTAAGG - Intronic
1098202035 12:68066512-68066534 TCTTCAAGACAGCAGAAGATGGG + Intergenic
1098673747 12:73264094-73264116 TTGAAAAGACAGCTGTACAATGG + Intergenic
1098994244 12:77099711-77099733 TTTTCAAGAACACTGAAGAAAGG + Intergenic
1101527455 12:105544630-105544652 TGGGCAAGGCAGCTGTAGAATGG + Intergenic
1105463490 13:20614548-20614570 TTGTTAGGAGAGATGAAGAAGGG + Intronic
1105594726 13:21826804-21826826 TTGACAAGACAGCAGGAGAAGGG - Intergenic
1106440758 13:29766519-29766541 TTGTTTAGACAGCACAAGAAGGG - Exonic
1106697076 13:32186651-32186673 TTGACAAGACAGCTATATAATGG - Intronic
1109394184 13:61733479-61733501 TTGTCAAGATACCTCAATAAAGG - Intergenic
1109501043 13:63236340-63236362 ATGGAATGACAGCTGAAGAAAGG + Intergenic
1110108690 13:71714666-71714688 TTGGAAAGTCAGCTCAAGAACGG - Intronic
1113553675 13:111214010-111214032 GTGTAATGACTGCTGAAGAATGG + Intronic
1114346362 14:21799477-21799499 TTGTCAGGAAAACTGAAGAAAGG + Intergenic
1114496577 14:23137154-23137176 TTCTGAAGACAGCAAAAGAAAGG + Intronic
1116340691 14:43719670-43719692 TTGTCAAGAAAGCAAAACAATGG + Intergenic
1117313509 14:54551784-54551806 TACTCAAGTCAGCTTAAGAACGG + Intergenic
1118154566 14:63226319-63226341 ATGGCAAGACACCTGGAGAAAGG + Intronic
1118418297 14:65569587-65569609 TGGACAAGACAGATGAAAAATGG - Intronic
1119342961 14:73896353-73896375 TTCTCAAAACAGCTGAGGAAGGG - Exonic
1119467925 14:74874172-74874194 TTGAAAAGAAAGCTGCAGAATGG + Intergenic
1119938060 14:78611124-78611146 ACGTGAAGACAGCTGAAAAATGG + Intronic
1120537304 14:85712821-85712843 TTGTCAAGATACCGGAACAAGGG + Intergenic
1120930712 14:89845600-89845622 CTTACAAGAGAGCTGAAGAATGG - Intronic
1122069534 14:99196596-99196618 CTGTCAAGACAGCTGCAGACAGG - Intronic
1124687058 15:31791757-31791779 GTGTCAAGACAGCCAAAGGAAGG - Intronic
1126692630 15:51299497-51299519 TGGTCAGGACAGCTGGAGAATGG + Intronic
1129170841 15:73806893-73806915 AGGTCAACAGAGCTGAAGAATGG - Intergenic
1129726867 15:77905910-77905932 TTGTCAAGAATGCCCAAGAATGG + Intergenic
1129754107 15:78085594-78085616 TGCTCATGACAGCTGGAGAAGGG - Intronic
1133886025 16:9828358-9828380 TTGTCAAGAGAGCTGATGAGGGG - Intronic
1137550745 16:49435860-49435882 ATTTCAAGAAAGCTGAAGAAAGG + Intergenic
1138651203 16:58462815-58462837 TGGACAAGACAGCTAAAGACAGG - Intergenic
1138906891 16:61347316-61347338 TTATCAACACTGCTGAAGATTGG + Intergenic
1140008287 16:71102628-71102650 TTGTCAGAACAGCTGAAGGTCGG - Intronic
1141226461 16:82120835-82120857 TTGTTTAGACATGTGAAGAATGG + Intergenic
1141596189 16:85098244-85098266 TTGTCAAGGCAGCCCAGGAAAGG + Intergenic
1142150609 16:88511006-88511028 TTGTCTCTGCAGCTGAAGAATGG - Intronic
1143051676 17:4131162-4131184 ATGCCAAGACAGGAGAAGAATGG + Intronic
1145118694 17:20236097-20236119 GTGGCAAGACAGCTGGAAAAGGG - Intronic
1147893048 17:43730876-43730898 TTTTCCAGATAGCTGAGGAAAGG + Intergenic
1149401586 17:56301951-56301973 TTGCCAAGACTGTTGAAGAGTGG - Intronic
1150315283 17:64163862-64163884 TTGTCAAGACTACAAAAGAAAGG - Intronic
1153185651 18:2483292-2483314 TTGGCCAGAAAGCTGGAGAAAGG - Intergenic
1159337789 18:67092185-67092207 ATGTTAAAACAGCTTAAGAAAGG - Intergenic
1163249110 19:16115667-16115689 TTGGCAAGAGGGCTGCAGAAAGG + Intronic
1164676387 19:30104375-30104397 TTTTCAGCACAGCTGAAGAAGGG + Intergenic
1167195350 19:48024397-48024419 TTGTCTACACATCTGATGAAAGG - Intronic
925119593 2:1407374-1407396 TTGTGGAGACAGCTGAAAACTGG + Intronic
925122769 2:1432264-1432286 TTGTCCAGGCACCTGCAGAATGG - Intronic
925805975 2:7648590-7648612 TTGCCAAGAAAGCGGAAGCATGG + Intergenic
926231473 2:11007419-11007441 TTCTCAACACAACTGAAGACGGG - Intergenic
926359362 2:12071046-12071068 GAGTGAAGACAGCTGTAGAAAGG + Intergenic
926758622 2:16256508-16256530 TTGTCAAGATGCTTGAAGAAGGG - Intergenic
929302380 2:40320653-40320675 GTGTTAAGACAAGTGAAGAATGG + Intronic
931485538 2:62687081-62687103 AAGTCAAAACAGCTGAAGACAGG - Intronic
932061669 2:68506757-68506779 TTGTGAAAACACCTGCAGAAAGG + Intronic
932455145 2:71844722-71844744 TTGTCTCGGCAGTTGAAGAAAGG + Intergenic
935525768 2:104164668-104164690 GTGTGAAGACAGAGGAAGAAAGG - Intergenic
935708864 2:105879971-105879993 CTCTCAGGACAGCTGAGGAAGGG + Intronic
936952456 2:117991950-117991972 ATTTCAAGTCAGCTAAAGAAGGG + Intronic
936964684 2:118116220-118116242 TTGCCAAGGCAGGGGAAGAATGG + Intergenic
936998373 2:118438882-118438904 TTTTCAAGGAAGCTGAGGAAGGG - Intergenic
938768578 2:134480662-134480684 TGGTGCAGACAACTGAAGAACGG + Intronic
940041913 2:149369910-149369932 TAGACAATACAGCTGAAGGAGGG + Intronic
940184994 2:150974321-150974343 TTGTTAAGACAGCTTGAGCAGGG - Intergenic
941174653 2:162181551-162181573 TGGTGAAGATAGCTGAGGAACGG - Intronic
943495863 2:188620014-188620036 ATGTCAAGACAGCTGAATAAAGG - Intergenic
944306259 2:198183420-198183442 TTGAGTAGACAGCTGTAGAAAGG + Intronic
944635942 2:201676219-201676241 TTCACAAGAGAGTTGAAGAAGGG + Intronic
944916952 2:204370599-204370621 TAGTCCAGACAGTTGAAAAAAGG + Intergenic
948744430 2:240076346-240076368 TTTTCAAGAAAGATGAAGACAGG + Intergenic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1170322617 20:15117063-15117085 TTGTCAAGACAGTTTTAGCATGG - Intronic
1170895696 20:20411814-20411836 TTAACAGGATAGCTGAAGAAAGG + Intronic
1176167851 20:63683399-63683421 CTGTCAAGACAGCTAAACACAGG - Intronic
1179282692 21:39947917-39947939 CTGTTAAGAAAGGTGAAGAAAGG + Intergenic
1181823572 22:25494765-25494787 TGGGCAAGCCAGCTGAAGAAAGG - Intergenic
1182873345 22:33668000-33668022 TTGGCAAGACAACTGAAAAATGG - Intronic
1184300324 22:43555082-43555104 TTGTCCAGACAGCTGATGAGTGG - Exonic
949400220 3:3657830-3657852 TTCACAAGACCGCTGAAAAAAGG + Intergenic
950015547 3:9752359-9752381 TTGTCATGAGGGTTGAAGAAAGG + Intronic
951601680 3:24383326-24383348 TTTTTAATACAGCTAAAGAATGG - Intronic
952027967 3:29106541-29106563 TTGTCTTGACAGGTGAAGACTGG - Intergenic
955091217 3:55752503-55752525 TTGCCAAGACTGCTGAACAAGGG + Intronic
955345145 3:58155626-58155648 TTGTCAACATTTCTGAAGAAAGG + Intronic
956870973 3:73417605-73417627 TAGTCAACACAGCAGAAGAGAGG - Intronic
957846625 3:85744881-85744903 TTGGCAGGGCAGCGGAAGAATGG + Intronic
962989837 3:140567827-140567849 TCATCAAAACAGCTTAAGAAGGG + Exonic
964661455 3:159124490-159124512 TTGAGCTGACAGCTGAAGAATGG - Intronic
965062741 3:163804041-163804063 ATATAATGACAGCTGAAGAAAGG + Intergenic
965824724 3:172719031-172719053 TTGGCAAGAAAGCTGAAGCAGGG + Intergenic
966030388 3:175339116-175339138 TCCTCAAGTCTGCTGAAGAATGG - Intronic
966078252 3:175965233-175965255 TTGGCAAGGCTGCAGAAGAAAGG - Intergenic
967342296 3:188412760-188412782 TTGTCAAGATAGATCAAGATAGG + Intronic
967582654 3:191178521-191178543 ATGTCAGGAATGCTGAAGAAAGG + Intergenic
968924734 4:3541314-3541336 TTGTCCATCCAGATGAAGAATGG + Intergenic
969149299 4:5155050-5155072 TGGTCAAGAGACTTGAAGAAGGG - Intronic
969986807 4:11219823-11219845 TTGTCAAGAATGCTAGAGAATGG - Intergenic
970683736 4:18541013-18541035 TTGTCAAAACAGGAAAAGAATGG + Intergenic
971608968 4:28696917-28696939 TTGACATGACATCTAAAGAAAGG + Intergenic
974065214 4:57071410-57071432 TTGTCAGCACAGATAAAGAAAGG - Intronic
974800214 4:66807660-66807682 CTGACAAGACAGCAGAAGGAAGG + Intergenic
974838865 4:67279843-67279865 ATATAATGACAGCTGAAGAAAGG - Intergenic
975595846 4:76047707-76047729 ATGGAATGACAGCTGAAGAAAGG - Intronic
976120033 4:81769846-81769868 TTGTCAAGCCACCCAAAGAAAGG + Intronic
976212889 4:82689602-82689624 TTGCCATGACAGCTGCAAAATGG - Intronic
976921888 4:90452519-90452541 TTGTTTTGACAGCTAAAGAATGG - Intronic
979290185 4:118971335-118971357 TTTTCAAGACAGCAGAGGACTGG + Intronic
980599124 4:134996948-134996970 TTTTGAAAACACCTGAAGAAGGG + Intergenic
981217075 4:142182705-142182727 ATGCCAAGACAGCTGAGAAAGGG - Intronic
981835923 4:149053240-149053262 GTGTCAAGATAGCAGGAGAAAGG + Intergenic
984571545 4:181400516-181400538 TAGTCAAGACACCTGAGGAAAGG + Intergenic
986598556 5:9448493-9448515 TTGTCTTGACAGATGATGAAGGG - Intronic
990688678 5:58337442-58337464 TTGTCAACAAACCTGAAGGATGG + Intergenic
992413476 5:76530889-76530911 TTGTAAAGAAAGCTGAAAAATGG + Intronic
992845141 5:80739183-80739205 TTGTCAGAACAGCGGAAGTAAGG + Intronic
995458734 5:112379788-112379810 TTGTCAAGACAACTGCTTAATGG + Intronic
995924396 5:117353328-117353350 TTGACAAAACAGAAGAAGAAGGG + Intergenic
997542958 5:134679665-134679687 TGATCAAGAAAGCTGACGAAAGG - Exonic
999587679 5:153108932-153108954 TTGAGATGACATCTGAAGAATGG - Intergenic
999606591 5:153323594-153323616 CTCTGAAGACAGCTGAAGATAGG - Intergenic
999684940 5:154094081-154094103 TTGCCAATACAGGTGAAGAATGG - Intronic
999806284 5:155084419-155084441 TTGTCAGGACAACTGAAAAATGG + Intergenic
999912114 5:156213573-156213595 CTTTCAAAAAAGCTGAAGAAGGG + Intronic
1001259059 5:170211242-170211264 TTGTCAAGATAGGAGAGGAAGGG + Intergenic
1002951228 6:1813442-1813464 TTCTCAAGTCAGGTGAAGATAGG - Intronic
1003429099 6:6022641-6022663 TTCTCAACACAGCTGATGCAGGG - Intergenic
1004728045 6:18329942-18329964 TAGTGAAGAAAGCGGAAGAAAGG + Intergenic
1005032862 6:21527689-21527711 TTTTCAAGGCACCTGAGGAAGGG - Intergenic
1005033561 6:21534677-21534699 TTTTCAAGACACCTGAGGAACGG - Intergenic
1005051844 6:21691613-21691635 ATGCCAAGAAAACTGAAGAAGGG + Intergenic
1007244506 6:40450920-40450942 TTGTCATGAGACCTGAAGGAGGG + Intronic
1011010022 6:82693363-82693385 TTGTCACTACAGCTGCAGAGTGG - Intergenic
1012402181 6:98849921-98849943 TTTCTAAGACAGCTAAAGAAAGG + Intergenic
1012527316 6:100193677-100193699 TTGTGAAGACAGCTGAACCTAGG - Intergenic
1014008957 6:116454642-116454664 TTTTCAAGAAAGCAGAAGAATGG - Intergenic
1014022596 6:116608261-116608283 TTGTGAAGACAGCAGAAGTTTGG - Intergenic
1018355790 6:163014490-163014512 TTGGCAAGACTGCAGAAAAAAGG - Intronic
1019003252 6:168773497-168773519 TAGTCAAGAGAGCTGAAGCTGGG - Intergenic
1019447502 7:1078996-1079018 CTGTCAAGACTGCTGGTGAATGG + Intronic
1019447513 7:1079055-1079077 CTGTCAAGACTGCTGGTGAATGG + Intronic
1019838177 7:3411870-3411892 TTGCCTAGAAATCTGAAGAAGGG + Intronic
1020909627 7:14112285-14112307 TTATCAAGAAAACAGAAGAAGGG - Intergenic
1024039617 7:45542138-45542160 TTGTCAGCACAAATGAAGAAGGG - Intergenic
1024446093 7:49481015-49481037 TTCTCTAGACATTTGAAGAAAGG - Intergenic
1026535151 7:71233057-71233079 AGGTCCAGAGAGCTGAAGAAGGG + Intronic
1028240002 7:88408328-88408350 TTTTCAAGGAAGCTGAAGATTGG + Intergenic
1030818366 7:114065053-114065075 TTGTCAAGACAGACAAAGTAGGG - Intronic
1030937813 7:115607354-115607376 TTGAGGAGATAGCTGAAGAAAGG - Intergenic
1031973229 7:128078447-128078469 TTGAGAAGACAGCAGAAGCAAGG - Intronic
1038122260 8:24630642-24630664 TAGTGAGGAAAGCTGAAGAAAGG - Intergenic
1038313839 8:26466142-26466164 TTGCCAAGACCGCAGAGGAAGGG + Intronic
1038581946 8:28755429-28755451 ACGTCAAGACAGATGAAGAAAGG - Intronic
1038919253 8:32064479-32064501 CTACCAAGACAGCTGAAGGATGG - Intronic
1038964032 8:32551393-32551415 ATGTTAAAACAGCTGAAGAGAGG - Intronic
1040037818 8:42887536-42887558 TTGGTAAGACAGCTGATGACAGG + Intronic
1040803136 8:51365634-51365656 TTGTCATTCCAGTTGAAGAAAGG - Intronic
1040826260 8:51623727-51623749 TTTTCAAAACAGCAAAAGAATGG - Intronic
1042340518 8:67674117-67674139 ATGTCATGACAACTGTAGAATGG - Intronic
1043573897 8:81634499-81634521 TGGAAAAGACAGCTGAATAATGG + Intergenic
1043579334 8:81693806-81693828 TGGAAAAGACAGCTGAATAACGG + Exonic
1044163600 8:88952010-88952032 TTTTCCAGGCACCTGAAGAATGG - Intergenic
1044646601 8:94449974-94449996 TAGTCCAGTCTGCTGAAGAAGGG - Intronic
1044740374 8:95320543-95320565 TTGTACAGACAGCTGTAAAAAGG + Intergenic
1046048673 8:108994117-108994139 TTGTCCAGACTGGTGAGGAATGG - Intergenic
1046166618 8:110444999-110445021 TGGTTAACATAGCTGAAGAAAGG + Intergenic
1051523430 9:18015914-18015936 TCAGCAAGACAGCTGGAGAAAGG - Intergenic
1052455686 9:28694406-28694428 TTGTTAATACAGATGTAGAAAGG - Intergenic
1052786977 9:32837864-32837886 TTGTCATGACAACTGAGGCATGG + Intergenic
1053799807 9:41757289-41757311 TTGTCCATCCAGATGAAGAATGG + Intergenic
1054145404 9:61557644-61557666 TTGTCCATCCAGATGAAGAATGG - Intergenic
1054188215 9:61969344-61969366 TTGTCCATCCAGATGAAGAATGG + Intergenic
1054465148 9:65488761-65488783 TTGTCCATCCAGATGAAGAATGG - Intergenic
1054650299 9:67619232-67619254 TTGTCCATCCAGATGAAGAATGG - Intergenic
1055236648 9:74130861-74130883 TTGTAAAAACAATTGAAGAAAGG + Intergenic
1055904432 9:81276299-81276321 TTGTCAAGATGCCAGAAGAACGG - Intergenic
1056049195 9:82750393-82750415 TTCTCTAGAAAACTGAAGAAAGG - Intergenic
1056431204 9:86529647-86529669 TTGTCCAGACAGATGAAGGCAGG + Intergenic
1057459608 9:95248768-95248790 TTGACAAGAGGGTTGAAGAAGGG + Intronic
1060462193 9:123867443-123867465 TTTTCAAGAAACCTGAAGATCGG + Intronic
1061969511 9:134036310-134036332 TGCCCCAGACAGCTGAAGAAAGG - Exonic
1186520053 X:10197851-10197873 TTGTCAAGACAGATGGGGAGGGG + Intronic
1188295668 X:28445293-28445315 TTGTGAAAAGAGCTGAAGACAGG - Intergenic
1188888183 X:35576661-35576683 TTGTCAAGAGCACTGAGGAAAGG + Intergenic
1188944738 X:36285492-36285514 TTGTCAAGACAGCTGAAGAAAGG - Intronic
1189630040 X:42943095-42943117 TTCTCAAGACAGGAGTAGAAAGG + Intergenic
1192249780 X:69402218-69402240 TTGTCAAAGCTGCTGAAGAGAGG - Intergenic
1194960134 X:100225404-100225426 TTGTAAAGTCAACTGAATAATGG + Intergenic
1198069116 X:133130463-133130485 CAGCCAAGACAGATGAAGAAAGG + Intergenic
1198168942 X:134085621-134085643 TCTTCAAGACAGCAGGAGAATGG - Intergenic
1202580335 Y:26374067-26374089 CAGTCAAGTAAGCTGAAGAAAGG + Intergenic