ID: 1188953002

View in Genome Browser
Species Human (GRCh38)
Location X:36399775-36399797
Sequence GGTGTCAGAGAAGCACAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188953002_1188953009 28 Left 1188953002 X:36399775-36399797 CCTACTTGTGCTTCTCTGACACC No data
Right 1188953009 X:36399826-36399848 TACAGTCTGACAAGTGTGAGTGG No data
1188953002_1188953004 -10 Left 1188953002 X:36399775-36399797 CCTACTTGTGCTTCTCTGACACC No data
Right 1188953004 X:36399788-36399810 CTCTGACACCACCTCAGTGAGGG No data
1188953002_1188953010 29 Left 1188953002 X:36399775-36399797 CCTACTTGTGCTTCTCTGACACC No data
Right 1188953010 X:36399827-36399849 ACAGTCTGACAAGTGTGAGTGGG No data
1188953002_1188953006 -3 Left 1188953002 X:36399775-36399797 CCTACTTGTGCTTCTCTGACACC No data
Right 1188953006 X:36399795-36399817 ACCACCTCAGTGAGGGGTCGTGG No data
1188953002_1188953005 -9 Left 1188953002 X:36399775-36399797 CCTACTTGTGCTTCTCTGACACC No data
Right 1188953005 X:36399789-36399811 TCTGACACCACCTCAGTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188953002 Original CRISPR GGTGTCAGAGAAGCACAAGT AGG (reversed) Intergenic
No off target data available for this crispr