ID: 1188957128

View in Genome Browser
Species Human (GRCh38)
Location X:36446826-36446848
Sequence GACATTCTACTGACCAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188957128_1188957130 13 Left 1188957128 X:36446826-36446848 CCACCTCTGGTCAGTAGAATGTC No data
Right 1188957130 X:36446862-36446884 TTTCCCAAATGTTGCCTCTTAGG No data
1188957128_1188957131 14 Left 1188957128 X:36446826-36446848 CCACCTCTGGTCAGTAGAATGTC No data
Right 1188957131 X:36446863-36446885 TTCCCAAATGTTGCCTCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188957128 Original CRISPR GACATTCTACTGACCAGAGG TGG (reversed) Intergenic
No off target data available for this crispr