ID: 1188960566

View in Genome Browser
Species Human (GRCh38)
Location X:36486584-36486606
Sequence TGTTTTCTCTGGAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188960566_1188960573 12 Left 1188960566 X:36486584-36486606 CCCTCCACCTTCCAGAGAAAACA No data
Right 1188960573 X:36486619-36486641 ATTATTGGTTAGATGCTATATGG No data
1188960566_1188960572 -3 Left 1188960566 X:36486584-36486606 CCCTCCACCTTCCAGAGAAAACA No data
Right 1188960572 X:36486604-36486626 ACAGATCTGAGGTAAATTATTGG No data
1188960566_1188960574 13 Left 1188960566 X:36486584-36486606 CCCTCCACCTTCCAGAGAAAACA No data
Right 1188960574 X:36486620-36486642 TTATTGGTTAGATGCTATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188960566 Original CRISPR TGTTTTCTCTGGAAGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr