ID: 1188964982

View in Genome Browser
Species Human (GRCh38)
Location X:36539826-36539848
Sequence AAGTAGACTTTGGAGTTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188964978_1188964982 5 Left 1188964978 X:36539798-36539820 CCTATGTGTAAACCACCAAACTG No data
Right 1188964982 X:36539826-36539848 AAGTAGACTTTGGAGTTGTTTGG No data
1188964980_1188964982 -10 Left 1188964980 X:36539813-36539835 CCAAACTGAACTCAAGTAGACTT No data
Right 1188964982 X:36539826-36539848 AAGTAGACTTTGGAGTTGTTTGG No data
1188964977_1188964982 11 Left 1188964977 X:36539792-36539814 CCGTCACCTATGTGTAAACCACC No data
Right 1188964982 X:36539826-36539848 AAGTAGACTTTGGAGTTGTTTGG No data
1188964979_1188964982 -7 Left 1188964979 X:36539810-36539832 CCACCAAACTGAACTCAAGTAGA No data
Right 1188964982 X:36539826-36539848 AAGTAGACTTTGGAGTTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188964982 Original CRISPR AAGTAGACTTTGGAGTTGTT TGG Intergenic
No off target data available for this crispr