ID: 1188968045

View in Genome Browser
Species Human (GRCh38)
Location X:36579209-36579231
Sequence TGGGAAGCTCCATTATTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188968040_1188968045 14 Left 1188968040 X:36579172-36579194 CCTGACCCACTGGATCAGAATCT No data
Right 1188968045 X:36579209-36579231 TGGGAAGCTCCATTATTAACAGG No data
1188968042_1188968045 8 Left 1188968042 X:36579178-36579200 CCACTGGATCAGAATCTGTATGA No data
Right 1188968045 X:36579209-36579231 TGGGAAGCTCCATTATTAACAGG No data
1188968039_1188968045 15 Left 1188968039 X:36579171-36579193 CCCTGACCCACTGGATCAGAATC No data
Right 1188968045 X:36579209-36579231 TGGGAAGCTCCATTATTAACAGG No data
1188968036_1188968045 20 Left 1188968036 X:36579166-36579188 CCCACCCCTGACCCACTGGATCA No data
Right 1188968045 X:36579209-36579231 TGGGAAGCTCCATTATTAACAGG No data
1188968037_1188968045 19 Left 1188968037 X:36579167-36579189 CCACCCCTGACCCACTGGATCAG No data
Right 1188968045 X:36579209-36579231 TGGGAAGCTCCATTATTAACAGG No data
1188968041_1188968045 9 Left 1188968041 X:36579177-36579199 CCCACTGGATCAGAATCTGTATG No data
Right 1188968045 X:36579209-36579231 TGGGAAGCTCCATTATTAACAGG No data
1188968038_1188968045 16 Left 1188968038 X:36579170-36579192 CCCCTGACCCACTGGATCAGAAT No data
Right 1188968045 X:36579209-36579231 TGGGAAGCTCCATTATTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188968045 Original CRISPR TGGGAAGCTCCATTATTAAC AGG Intergenic
No off target data available for this crispr