ID: 1188975729

View in Genome Browser
Species Human (GRCh38)
Location X:36673028-36673050
Sequence AGGTTAATACACTTGGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188975729_1188975731 -10 Left 1188975729 X:36673028-36673050 CCTTGTTCCAAGTGTATTAACCT No data
Right 1188975731 X:36673041-36673063 GTATTAACCTTTTTATGTATTGG No data
1188975729_1188975733 -2 Left 1188975729 X:36673028-36673050 CCTTGTTCCAAGTGTATTAACCT No data
Right 1188975733 X:36673049-36673071 CTTTTTATGTATTGGAGATTTGG No data
1188975729_1188975734 18 Left 1188975729 X:36673028-36673050 CCTTGTTCCAAGTGTATTAACCT No data
Right 1188975734 X:36673069-36673091 TGGCTTGCTGTTATTGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188975729 Original CRISPR AGGTTAATACACTTGGAACA AGG (reversed) Intergenic
No off target data available for this crispr