ID: 1188976651

View in Genome Browser
Species Human (GRCh38)
Location X:36683541-36683563
Sequence CTGAGTGAGCAGATGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188976651_1188976657 29 Left 1188976651 X:36683541-36683563 CCTTCCACCATCTGCTCACTCAG No data
Right 1188976657 X:36683593-36683615 GTTTTTGGCAAATGTTGCCTGGG No data
1188976651_1188976655 14 Left 1188976651 X:36683541-36683563 CCTTCCACCATCTGCTCACTCAG No data
Right 1188976655 X:36683578-36683600 TATCTGTCTTTAAATGTTTTTGG No data
1188976651_1188976656 28 Left 1188976651 X:36683541-36683563 CCTTCCACCATCTGCTCACTCAG No data
Right 1188976656 X:36683592-36683614 TGTTTTTGGCAAATGTTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188976651 Original CRISPR CTGAGTGAGCAGATGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr