ID: 1188979538

View in Genome Browser
Species Human (GRCh38)
Location X:36714666-36714688
Sequence TCCCATGTCCTCCCTTAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188979538_1188979544 17 Left 1188979538 X:36714666-36714688 CCAGCTTAAGGGAGGACATGGGA No data
Right 1188979544 X:36714706-36714728 AAAGGCATCAAACTTATGGTAGG No data
1188979538_1188979541 -1 Left 1188979538 X:36714666-36714688 CCAGCTTAAGGGAGGACATGGGA No data
Right 1188979541 X:36714688-36714710 AAAATGTCCATGGATGGCAAAGG No data
1188979538_1188979547 30 Left 1188979538 X:36714666-36714688 CCAGCTTAAGGGAGGACATGGGA No data
Right 1188979547 X:36714719-36714741 TTATGGTAGGAATCAGGAGGAGG No data
1188979538_1188979543 13 Left 1188979538 X:36714666-36714688 CCAGCTTAAGGGAGGACATGGGA No data
Right 1188979543 X:36714702-36714724 TGGCAAAGGCATCAAACTTATGG No data
1188979538_1188979546 27 Left 1188979538 X:36714666-36714688 CCAGCTTAAGGGAGGACATGGGA No data
Right 1188979546 X:36714716-36714738 AACTTATGGTAGGAATCAGGAGG No data
1188979538_1188979540 -7 Left 1188979538 X:36714666-36714688 CCAGCTTAAGGGAGGACATGGGA No data
Right 1188979540 X:36714682-36714704 CATGGGAAAATGTCCATGGATGG No data
1188979538_1188979545 24 Left 1188979538 X:36714666-36714688 CCAGCTTAAGGGAGGACATGGGA No data
Right 1188979545 X:36714713-36714735 TCAAACTTATGGTAGGAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188979538 Original CRISPR TCCCATGTCCTCCCTTAAGC TGG (reversed) Intergenic
No off target data available for this crispr