ID: 1188979542

View in Genome Browser
Species Human (GRCh38)
Location X:36714695-36714717
Sequence TTTGATGCCTTTGCCATCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188979542_1188979546 -2 Left 1188979542 X:36714695-36714717 CCATGGATGGCAAAGGCATCAAA No data
Right 1188979546 X:36714716-36714738 AACTTATGGTAGGAATCAGGAGG No data
1188979542_1188979547 1 Left 1188979542 X:36714695-36714717 CCATGGATGGCAAAGGCATCAAA No data
Right 1188979547 X:36714719-36714741 TTATGGTAGGAATCAGGAGGAGG No data
1188979542_1188979545 -5 Left 1188979542 X:36714695-36714717 CCATGGATGGCAAAGGCATCAAA No data
Right 1188979545 X:36714713-36714735 TCAAACTTATGGTAGGAATCAGG No data
1188979542_1188979548 2 Left 1188979542 X:36714695-36714717 CCATGGATGGCAAAGGCATCAAA No data
Right 1188979548 X:36714720-36714742 TATGGTAGGAATCAGGAGGAGGG No data
1188979542_1188979549 3 Left 1188979542 X:36714695-36714717 CCATGGATGGCAAAGGCATCAAA No data
Right 1188979549 X:36714721-36714743 ATGGTAGGAATCAGGAGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188979542 Original CRISPR TTTGATGCCTTTGCCATCCA TGG (reversed) Intergenic
No off target data available for this crispr