ID: 1188979546

View in Genome Browser
Species Human (GRCh38)
Location X:36714716-36714738
Sequence AACTTATGGTAGGAATCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188979538_1188979546 27 Left 1188979538 X:36714666-36714688 CCAGCTTAAGGGAGGACATGGGA No data
Right 1188979546 X:36714716-36714738 AACTTATGGTAGGAATCAGGAGG No data
1188979542_1188979546 -2 Left 1188979542 X:36714695-36714717 CCATGGATGGCAAAGGCATCAAA No data
Right 1188979546 X:36714716-36714738 AACTTATGGTAGGAATCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188979546 Original CRISPR AACTTATGGTAGGAATCAGG AGG Intergenic
No off target data available for this crispr