ID: 1188979771

View in Genome Browser
Species Human (GRCh38)
Location X:36716568-36716590
Sequence GGGTGCAGCAAGAATAAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188979768_1188979771 10 Left 1188979768 X:36716535-36716557 CCAAGGTGGGGAATCTGTGGGTT No data
Right 1188979771 X:36716568-36716590 GGGTGCAGCAAGAATAAGATAGG No data
1188979765_1188979771 14 Left 1188979765 X:36716531-36716553 CCAACCAAGGTGGGGAATCTGTG No data
Right 1188979771 X:36716568-36716590 GGGTGCAGCAAGAATAAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188979771 Original CRISPR GGGTGCAGCAAGAATAAGAT AGG Intergenic
No off target data available for this crispr