ID: 1188985979

View in Genome Browser
Species Human (GRCh38)
Location X:36768725-36768747
Sequence CTTCATGTGTGGATGGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188985979_1188985990 25 Left 1188985979 X:36768725-36768747 CCATGCACCATCCACACATGAAG No data
Right 1188985990 X:36768773-36768795 CCATCTACTAGGATTCAACTTGG No data
1188985979_1188985987 14 Left 1188985979 X:36768725-36768747 CCATGCACCATCCACACATGAAG No data
Right 1188985987 X:36768762-36768784 CCTACCATGCACCATCTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188985979 Original CRISPR CTTCATGTGTGGATGGTGCA TGG (reversed) Intergenic
No off target data available for this crispr