ID: 1188987523

View in Genome Browser
Species Human (GRCh38)
Location X:36780772-36780794
Sequence GTGCAGAATACAACCAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188987523_1188987530 29 Left 1188987523 X:36780772-36780794 CCTTCACTGGTTGTATTCTGCAC No data
Right 1188987530 X:36780824-36780846 TTCTGACACTTACTGCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188987523 Original CRISPR GTGCAGAATACAACCAGTGA AGG (reversed) Intergenic
No off target data available for this crispr