ID: 1188993718

View in Genome Browser
Species Human (GRCh38)
Location X:36856017-36856039
Sequence CTCTCACAGCCAGGGCTCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188993715_1188993718 3 Left 1188993715 X:36855991-36856013 CCTTGCGTTGGAAAGAGGTCTGT No data
Right 1188993718 X:36856017-36856039 CTCTCACAGCCAGGGCTCTATGG No data
1188993712_1188993718 22 Left 1188993712 X:36855972-36855994 CCTTGGGCATTGATGGGATCCTT No data
Right 1188993718 X:36856017-36856039 CTCTCACAGCCAGGGCTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188993718 Original CRISPR CTCTCACAGCCAGGGCTCTA TGG Intergenic
No off target data available for this crispr