ID: 1188994232

View in Genome Browser
Species Human (GRCh38)
Location X:36862671-36862693
Sequence TGTTACACGAAGCACTTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188994231_1188994232 8 Left 1188994231 X:36862640-36862662 CCTGCTTGTAAATAAATGTATTG No data
Right 1188994232 X:36862671-36862693 TGTTACACGAAGCACTTTGCAGG No data
1188994228_1188994232 28 Left 1188994228 X:36862620-36862642 CCCACCTATATATCATATGACCT No data
Right 1188994232 X:36862671-36862693 TGTTACACGAAGCACTTTGCAGG No data
1188994229_1188994232 27 Left 1188994229 X:36862621-36862643 CCACCTATATATCATATGACCTG No data
Right 1188994232 X:36862671-36862693 TGTTACACGAAGCACTTTGCAGG No data
1188994230_1188994232 24 Left 1188994230 X:36862624-36862646 CCTATATATCATATGACCTGCTT No data
Right 1188994232 X:36862671-36862693 TGTTACACGAAGCACTTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188994232 Original CRISPR TGTTACACGAAGCACTTTGC AGG Intergenic
No off target data available for this crispr