ID: 1188998107

View in Genome Browser
Species Human (GRCh38)
Location X:36911016-36911038
Sequence CCTCTTCTATTGGGCAAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188998107_1188998116 28 Left 1188998107 X:36911016-36911038 CCCCTTTTGCCCAATAGAAGAGG No data
Right 1188998116 X:36911067-36911089 GTTAAGAAACAGAAATAATTGGG No data
1188998107_1188998117 29 Left 1188998107 X:36911016-36911038 CCCCTTTTGCCCAATAGAAGAGG No data
Right 1188998117 X:36911068-36911090 TTAAGAAACAGAAATAATTGGGG No data
1188998107_1188998115 27 Left 1188998107 X:36911016-36911038 CCCCTTTTGCCCAATAGAAGAGG No data
Right 1188998115 X:36911066-36911088 TGTTAAGAAACAGAAATAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188998107 Original CRISPR CCTCTTCTATTGGGCAAAAG GGG (reversed) Intergenic