ID: 1188998116

View in Genome Browser
Species Human (GRCh38)
Location X:36911067-36911089
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188998109_1188998116 27 Left 1188998109 X:36911017-36911039 CCCTTTTGCCCAATAGAAGAGGC No data
Right 1188998116 X:36911067-36911089 GTTAAGAAACAGAAATAATTGGG No data
1188998110_1188998116 26 Left 1188998110 X:36911018-36911040 CCTTTTGCCCAATAGAAGAGGCT No data
Right 1188998116 X:36911067-36911089 GTTAAGAAACAGAAATAATTGGG No data
1188998112_1188998116 18 Left 1188998112 X:36911026-36911048 CCAATAGAAGAGGCTCCTCGTGA No data
Right 1188998116 X:36911067-36911089 GTTAAGAAACAGAAATAATTGGG No data
1188998107_1188998116 28 Left 1188998107 X:36911016-36911038 CCCCTTTTGCCCAATAGAAGAGG No data
Right 1188998116 X:36911067-36911089 GTTAAGAAACAGAAATAATTGGG No data
1188998111_1188998116 19 Left 1188998111 X:36911025-36911047 CCCAATAGAAGAGGCTCCTCGTG No data
Right 1188998116 X:36911067-36911089 GTTAAGAAACAGAAATAATTGGG No data
1188998113_1188998116 3 Left 1188998113 X:36911041-36911063 CCTCGTGAATATTTTTGTCAATA No data
Right 1188998116 X:36911067-36911089 GTTAAGAAACAGAAATAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188998116 Original CRISPR GTTAAGAAACAGAAATAATT GGG Intergenic