ID: 1189001935

View in Genome Browser
Species Human (GRCh38)
Location X:36957499-36957521
Sequence CCTGGCCCGCGGAGGGAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189001935_1189001950 12 Left 1189001935 X:36957499-36957521 CCGGGCTCCCTCCGCGGGCCAGG No data
Right 1189001950 X:36957534-36957556 GCGGGATCCGCGCGAGCCTCGGG No data
1189001935_1189001945 -7 Left 1189001935 X:36957499-36957521 CCGGGCTCCCTCCGCGGGCCAGG No data
Right 1189001945 X:36957515-36957537 GGCCAGGGCCGCGGTAGGGGCGG No data
1189001935_1189001954 25 Left 1189001935 X:36957499-36957521 CCGGGCTCCCTCCGCGGGCCAGG No data
Right 1189001954 X:36957547-36957569 GAGCCTCGGGCCCTGGGAGCAGG No data
1189001935_1189001946 -6 Left 1189001935 X:36957499-36957521 CCGGGCTCCCTCCGCGGGCCAGG No data
Right 1189001946 X:36957516-36957538 GCCAGGGCCGCGGTAGGGGCGGG No data
1189001935_1189001944 -10 Left 1189001935 X:36957499-36957521 CCGGGCTCCCTCCGCGGGCCAGG No data
Right 1189001944 X:36957512-36957534 GCGGGCCAGGGCCGCGGTAGGGG No data
1189001935_1189001949 11 Left 1189001935 X:36957499-36957521 CCGGGCTCCCTCCGCGGGCCAGG No data
Right 1189001949 X:36957533-36957555 GGCGGGATCCGCGCGAGCCTCGG No data
1189001935_1189001951 18 Left 1189001935 X:36957499-36957521 CCGGGCTCCCTCCGCGGGCCAGG No data
Right 1189001951 X:36957540-36957562 TCCGCGCGAGCCTCGGGCCCTGG No data
1189001935_1189001953 19 Left 1189001935 X:36957499-36957521 CCGGGCTCCCTCCGCGGGCCAGG No data
Right 1189001953 X:36957541-36957563 CCGCGCGAGCCTCGGGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189001935 Original CRISPR CCTGGCCCGCGGAGGGAGCC CGG (reversed) Intergenic
No off target data available for this crispr