ID: 1189001938

View in Genome Browser
Species Human (GRCh38)
Location X:36957506-36957528
Sequence CCGCGGCCCTGGCCCGCGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189001938_1189001953 12 Left 1189001938 X:36957506-36957528 CCCTCCGCGGGCCAGGGCCGCGG No data
Right 1189001953 X:36957541-36957563 CCGCGCGAGCCTCGGGCCCTGGG No data
1189001938_1189001949 4 Left 1189001938 X:36957506-36957528 CCCTCCGCGGGCCAGGGCCGCGG No data
Right 1189001949 X:36957533-36957555 GGCGGGATCCGCGCGAGCCTCGG No data
1189001938_1189001951 11 Left 1189001938 X:36957506-36957528 CCCTCCGCGGGCCAGGGCCGCGG No data
Right 1189001951 X:36957540-36957562 TCCGCGCGAGCCTCGGGCCCTGG No data
1189001938_1189001954 18 Left 1189001938 X:36957506-36957528 CCCTCCGCGGGCCAGGGCCGCGG No data
Right 1189001954 X:36957547-36957569 GAGCCTCGGGCCCTGGGAGCAGG No data
1189001938_1189001950 5 Left 1189001938 X:36957506-36957528 CCCTCCGCGGGCCAGGGCCGCGG No data
Right 1189001950 X:36957534-36957556 GCGGGATCCGCGCGAGCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189001938 Original CRISPR CCGCGGCCCTGGCCCGCGGA GGG (reversed) Intergenic
No off target data available for this crispr