ID: 1189001940

View in Genome Browser
Species Human (GRCh38)
Location X:36957507-36957529
Sequence ACCGCGGCCCTGGCCCGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189001940_1189001949 3 Left 1189001940 X:36957507-36957529 CCTCCGCGGGCCAGGGCCGCGGT No data
Right 1189001949 X:36957533-36957555 GGCGGGATCCGCGCGAGCCTCGG No data
1189001940_1189001954 17 Left 1189001940 X:36957507-36957529 CCTCCGCGGGCCAGGGCCGCGGT No data
Right 1189001954 X:36957547-36957569 GAGCCTCGGGCCCTGGGAGCAGG No data
1189001940_1189001951 10 Left 1189001940 X:36957507-36957529 CCTCCGCGGGCCAGGGCCGCGGT No data
Right 1189001951 X:36957540-36957562 TCCGCGCGAGCCTCGGGCCCTGG No data
1189001940_1189001953 11 Left 1189001940 X:36957507-36957529 CCTCCGCGGGCCAGGGCCGCGGT No data
Right 1189001953 X:36957541-36957563 CCGCGCGAGCCTCGGGCCCTGGG No data
1189001940_1189001950 4 Left 1189001940 X:36957507-36957529 CCTCCGCGGGCCAGGGCCGCGGT No data
Right 1189001950 X:36957534-36957556 GCGGGATCCGCGCGAGCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189001940 Original CRISPR ACCGCGGCCCTGGCCCGCGG AGG (reversed) Intergenic
No off target data available for this crispr