ID: 1189001948

View in Genome Browser
Species Human (GRCh38)
Location X:36957523-36957545
Sequence CGCGGATCCCGCCCCTACCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189001948_1189001954 1 Left 1189001948 X:36957523-36957545 CCGCGGTAGGGGCGGGATCCGCG No data
Right 1189001954 X:36957547-36957569 GAGCCTCGGGCCCTGGGAGCAGG No data
1189001948_1189001953 -5 Left 1189001948 X:36957523-36957545 CCGCGGTAGGGGCGGGATCCGCG No data
Right 1189001953 X:36957541-36957563 CCGCGCGAGCCTCGGGCCCTGGG No data
1189001948_1189001951 -6 Left 1189001948 X:36957523-36957545 CCGCGGTAGGGGCGGGATCCGCG No data
Right 1189001951 X:36957540-36957562 TCCGCGCGAGCCTCGGGCCCTGG No data
1189001948_1189001959 17 Left 1189001948 X:36957523-36957545 CCGCGGTAGGGGCGGGATCCGCG No data
Right 1189001959 X:36957563-36957585 GAGCAGGAGCCGAAGTCACCGGG No data
1189001948_1189001960 23 Left 1189001948 X:36957523-36957545 CCGCGGTAGGGGCGGGATCCGCG No data
Right 1189001960 X:36957569-36957591 GAGCCGAAGTCACCGGGTGCTGG No data
1189001948_1189001958 16 Left 1189001948 X:36957523-36957545 CCGCGGTAGGGGCGGGATCCGCG No data
Right 1189001958 X:36957562-36957584 GGAGCAGGAGCCGAAGTCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189001948 Original CRISPR CGCGGATCCCGCCCCTACCG CGG (reversed) Intergenic
No off target data available for this crispr