ID: 1189001953

View in Genome Browser
Species Human (GRCh38)
Location X:36957541-36957563
Sequence CCGCGCGAGCCTCGGGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189001947_1189001953 1 Left 1189001947 X:36957517-36957539 CCAGGGCCGCGGTAGGGGCGGGA No data
Right 1189001953 X:36957541-36957563 CCGCGCGAGCCTCGGGCCCTGGG No data
1189001938_1189001953 12 Left 1189001938 X:36957506-36957528 CCCTCCGCGGGCCAGGGCCGCGG No data
Right 1189001953 X:36957541-36957563 CCGCGCGAGCCTCGGGCCCTGGG No data
1189001940_1189001953 11 Left 1189001940 X:36957507-36957529 CCTCCGCGGGCCAGGGCCGCGGT No data
Right 1189001953 X:36957541-36957563 CCGCGCGAGCCTCGGGCCCTGGG No data
1189001948_1189001953 -5 Left 1189001948 X:36957523-36957545 CCGCGGTAGGGGCGGGATCCGCG No data
Right 1189001953 X:36957541-36957563 CCGCGCGAGCCTCGGGCCCTGGG No data
1189001941_1189001953 8 Left 1189001941 X:36957510-36957532 CCGCGGGCCAGGGCCGCGGTAGG No data
Right 1189001953 X:36957541-36957563 CCGCGCGAGCCTCGGGCCCTGGG No data
1189001935_1189001953 19 Left 1189001935 X:36957499-36957521 CCGGGCTCCCTCCGCGGGCCAGG No data
Right 1189001953 X:36957541-36957563 CCGCGCGAGCCTCGGGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189001953 Original CRISPR CCGCGCGAGCCTCGGGCCCT GGG Intergenic
No off target data available for this crispr