ID: 1189002061

View in Genome Browser
Species Human (GRCh38)
Location X:36957880-36957902
Sequence CGCTGCCGCCCGAGGACGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189002061_1189002068 1 Left 1189002061 X:36957880-36957902 CCTGGCGTCCTCGGGCGGCAGCG No data
Right 1189002068 X:36957904-36957926 CATCCAGGAATGGCTTCGGCGGG No data
1189002061_1189002070 7 Left 1189002061 X:36957880-36957902 CCTGGCGTCCTCGGGCGGCAGCG No data
Right 1189002070 X:36957910-36957932 GGAATGGCTTCGGCGGGCAGCGG No data
1189002061_1189002074 30 Left 1189002061 X:36957880-36957902 CCTGGCGTCCTCGGGCGGCAGCG No data
Right 1189002074 X:36957933-36957955 CATGGAGGAGGTGCGCGTGTCGG No data
1189002061_1189002071 12 Left 1189002061 X:36957880-36957902 CCTGGCGTCCTCGGGCGGCAGCG No data
Right 1189002071 X:36957915-36957937 GGCTTCGGCGGGCAGCGGCATGG No data
1189002061_1189002073 18 Left 1189002061 X:36957880-36957902 CCTGGCGTCCTCGGGCGGCAGCG No data
Right 1189002073 X:36957921-36957943 GGCGGGCAGCGGCATGGAGGAGG No data
1189002061_1189002072 15 Left 1189002061 X:36957880-36957902 CCTGGCGTCCTCGGGCGGCAGCG No data
Right 1189002072 X:36957918-36957940 TTCGGCGGGCAGCGGCATGGAGG No data
1189002061_1189002066 -3 Left 1189002061 X:36957880-36957902 CCTGGCGTCCTCGGGCGGCAGCG No data
Right 1189002066 X:36957900-36957922 GCGGCATCCAGGAATGGCTTCGG No data
1189002061_1189002067 0 Left 1189002061 X:36957880-36957902 CCTGGCGTCCTCGGGCGGCAGCG No data
Right 1189002067 X:36957903-36957925 GCATCCAGGAATGGCTTCGGCGG No data
1189002061_1189002065 -9 Left 1189002061 X:36957880-36957902 CCTGGCGTCCTCGGGCGGCAGCG No data
Right 1189002065 X:36957894-36957916 GCGGCAGCGGCATCCAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189002061 Original CRISPR CGCTGCCGCCCGAGGACGCC AGG (reversed) Intergenic
No off target data available for this crispr