ID: 1189004944

View in Genome Browser
Species Human (GRCh38)
Location X:36985680-36985702
Sequence ACGCTCGTATACCACGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189004944_1189004960 30 Left 1189004944 X:36985680-36985702 CCCAGGGCGTGGTATACGAGCGT No data
Right 1189004960 X:36985733-36985755 CAGGAAGGCGGCGCGGGTGTCGG No data
1189004944_1189004953 18 Left 1189004944 X:36985680-36985702 CCCAGGGCGTGGTATACGAGCGT No data
Right 1189004953 X:36985721-36985743 CGCGCCCCCGAGCAGGAAGGCGG No data
1189004944_1189004956 23 Left 1189004944 X:36985680-36985702 CCCAGGGCGTGGTATACGAGCGT No data
Right 1189004956 X:36985726-36985748 CCCCGAGCAGGAAGGCGGCGCGG No data
1189004944_1189004950 15 Left 1189004944 X:36985680-36985702 CCCAGGGCGTGGTATACGAGCGT No data
Right 1189004950 X:36985718-36985740 GCCCGCGCCCCCGAGCAGGAAGG No data
1189004944_1189004958 24 Left 1189004944 X:36985680-36985702 CCCAGGGCGTGGTATACGAGCGT No data
Right 1189004958 X:36985727-36985749 CCCGAGCAGGAAGGCGGCGCGGG No data
1189004944_1189004949 11 Left 1189004944 X:36985680-36985702 CCCAGGGCGTGGTATACGAGCGT No data
Right 1189004949 X:36985714-36985736 ACACGCCCGCGCCCCCGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189004944 Original CRISPR ACGCTCGTATACCACGCCCT GGG (reversed) Intergenic
No off target data available for this crispr